COQ10B cDNA ORF Clone, Human, N-His tag

Cat: HG15461-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All COQ10B Reagents
CRO Services
Product recommended

All COQ10B Reagents
COQ10B cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
717 bp
Description
Full length Clone DNA of Human coenzyme Q10 homolog B (S. cerevisiae) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

COQ10B Background Information
Full Name
coenzyme Q10 homolog B (S. cerevisiae)

COQ10B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
COQ10B cDNA ORF Clone in Cloning Vector, Mouse MG5A6752-U
COQ10B cDNA ORF Clone, Mouse, untagged MG5A6752-UT
COQ10B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A6752-ACGLN
COQ10B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A6752-ACG
COQ10B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A6752-ANG
COQ10B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A6752-ACR
COQ10B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A6752-ANR
COQ10B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A6752-CF
COQ10B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A6752-NF
COQ10B cDNA ORF Clone, Mouse, C-His tag MG5A6752-CH
COQ10B cDNA ORF Clone, Mouse, N-His tag MG5A6752-NH
COQ10B cDNA ORF Clone, Mouse, C-HA tag MG5A6752-CY
COQ10B cDNA ORF Clone, Mouse, N-HA tag MG5A6752-NY
COQ10B cDNA ORF Clone, Mouse, C-Myc tag MG5A6752-CM
COQ10B cDNA ORF Clone, Mouse, N-Myc tag MG5A6752-NM

COQ10B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
COQ10B cDNA ORF Clone in Cloning Vector, Human HG15461-G
COQ10B cDNA ORF Clone, Human, untagged HG15461-UT
COQ10B cDNA ORF Clone, Human, C-GFPSpark® tag HG15461-ACG
COQ10B Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15461-ACGLN
COQ10B cDNA ORF Clone, Human, C-OFPSpark® tag HG15461-ACR
COQ10B cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15461-CF
COQ10B cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15461-NF
COQ10B cDNA ORF Clone, Human, C-His tag HG15461-CH
COQ10B cDNA ORF Clone, Human, C-HA tag HG15461-CY
COQ10B cDNA ORF Clone, Human, N-HA tag HG15461-NY
COQ10B cDNA ORF Clone, Human, C-Myc tag HG15461-CM
COQ10B cDNA ORF Clone, Human, N-Myc tag HG15461-NM
COQ10B qPCR Primer Pairs, Human HP104085
info info
添加购物车成功! 添加购物车失败!