COPZ1 cDNA ORF Clone, Human, N-His tag

Cat: HG14933-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All COPZ1 Reagents
CRO Services
Product recommended

All COPZ1 Reagents
COPZ1 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
534 bp
Description
Full length Clone DNA of Human coatomer protein complex, subunit zeta 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

COPZ1 cDNA ORF Clone, Human, N-His tag Alternative Names
CGI-120 cDNA ORF Clone, Human;COPZ cDNA ORF Clone, Human;HSPC181 cDNA ORF Clone, Human;zeta-COP cDNA ORF Clone, Human;zeta1-COP cDNA ORF Clone, Human
COPZ1 Background Information
Full Name
coatomer protein complex, subunit zeta 1

COPZ1 cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
COPZ1 cDNA ORF Clone in Cloning Vector, Rabbit TG65127-G
COPZ1 cDNA ORF Clone, Rabbit, untagged TG65127-UT
COPZ1 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65127-ACG
COPZ1 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65127-ANG
COPZ1 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65127-ACR
COPZ1 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65127-ANR
COPZ1 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65127-CF
COPZ1 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65127-NF
COPZ1 cDNA ORF Clone, Rabbit, C-His tag TG65127-CH
COPZ1 cDNA ORF Clone, Rabbit, N-His tag TG65127-NH
COPZ1 cDNA ORF Clone, Rabbit, C-HA tag TG65127-CY
COPZ1 cDNA ORF Clone, Rabbit, N-HA tag TG65127-NY
COPZ1 cDNA ORF Clone, Rabbit, C-Myc tag TG65127-CM
COPZ1 cDNA ORF Clone, Rabbit, N-Myc tag TG65127-NM

COPZ1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
COPZ1 cDNA ORF Clone in Cloning Vector, Rat RG80636-U
COPZ1 cDNA ORF Clone, Rat, untagged RG80636-UT
COPZ1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80636-ACG
COPZ1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80636-ACGLN
COPZ1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80636-ANG
COPZ1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80636-ACR
COPZ1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80636-ANR
COPZ1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80636-CF
COPZ1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80636-NF
COPZ1 cDNA ORF Clone, Rat, C-His tag RG80636-CH
COPZ1 cDNA ORF Clone, Rat, N-His tag RG80636-NH
COPZ1 cDNA ORF Clone, Rat, C-HA tag RG80636-CY
COPZ1 cDNA ORF Clone, Rat, N-HA tag RG80636-NY
COPZ1 cDNA ORF Clone, Rat, C-Myc tag RG80636-CM
COPZ1 cDNA ORF Clone, Rat, N-Myc tag RG80636-NM
COPZ1 qPCR Primer Pairs, Rat RP300600

COPZ1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
COPZ1 cDNA ORF Clone in Cloning Vector, Mouse MG52093-G
COPZ1 cDNA ORF Clone, Mouse, untagged MG52093-UT
COPZ1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52093-ACG
COPZ1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52093-ACGLN
COPZ1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52093-ANG
COPZ1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52093-ACR
COPZ1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52093-ANR
COPZ1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52093-CF
COPZ1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52093-NF
COPZ1 cDNA ORF Clone, Mouse, C-His tag MG52093-CH
COPZ1 cDNA ORF Clone, Mouse, N-His tag MG52093-NH
COPZ1 cDNA ORF Clone, Mouse, C-HA tag MG52093-CY
COPZ1 cDNA ORF Clone, Mouse, N-HA tag MG52093-NY
COPZ1 cDNA ORF Clone, Mouse, C-Myc tag MG52093-CM
COPZ1 cDNA ORF Clone, Mouse, N-Myc tag MG52093-NM
COPZ1 qPCR Primer Pairs, Mouse MP201966

COPZ1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
COPZ1 cDNA ORF Clone in Cloning Vector, Human HG14933-G
COPZ1 cDNA ORF Clone, Human, untagged HG14933-UT
COPZ1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14933-ACG
COPZ1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14933-ACGLN
COPZ1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14933-ANG
COPZ1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14933-ACR
COPZ1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14933-ANR
COPZ1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14933-CF
COPZ1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14933-NF
COPZ1 cDNA ORF Clone, Human, C-His tag HG14933-CH
COPZ1 cDNA ORF Clone, Human, C-HA tag HG14933-CY
COPZ1 cDNA ORF Clone, Human, N-HA tag HG14933-NY
COPZ1 cDNA ORF Clone, Human, C-Myc tag HG14933-CM
COPZ1 cDNA ORF Clone, Human, N-Myc tag HG14933-NM
COPZ1 qPCR Primer Pairs, Human HP103562
info info
添加购物车成功! 添加购物车失败!