COPS8 cDNA ORF Clone, Human, untagged

Cat: HG16187-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All COPS8 Reagents
CRO Services
Product recommended

All COPS8 Reagents
COPS8 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
630 bp
Description
Full length Clone DNA of Human COP9 signalosome subunit 8.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

COPS8 cDNA ORF Clone, Human, untagged Alternative Names
COP9 cDNA ORF Clone, Human;CSN8 cDNA ORF Clone, Human;SGN8 cDNA ORF Clone, Human
COPS8 Background Information
Full Name
COP9 signalosome subunit 8

COPS8 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
COPS8 cDNA ORF Clone in Cloning Vector, Rat RG89838-U
COPS8 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG89838-ACGLN

COPS8 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
COPS8 cDNA ORF Clone in Cloning Vector, Mouse MG52242-G
COPS8 cDNA ORF Clone, Mouse, untagged MG52242-UT
COPS8 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52242-ACGLN
COPS8 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52242-ACG
COPS8 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52242-ANG
COPS8 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52242-ACR
COPS8 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52242-ANR
COPS8 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52242-CF
COPS8 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52242-NF
COPS8 cDNA ORF Clone, Mouse, C-His tag MG52242-CH
COPS8 cDNA ORF Clone, Mouse, N-His tag MG52242-NH
COPS8 cDNA ORF Clone, Mouse, C-HA tag MG52242-CY
COPS8 cDNA ORF Clone, Mouse, N-HA tag MG52242-NY
COPS8 cDNA ORF Clone, Mouse, C-Myc tag MG52242-CM
COPS8 cDNA ORF Clone, Mouse, N-Myc tag MG52242-NM
COPS8 qPCR Primer Pairs, Mouse MP202115

COPS8 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
COPS8 cDNA ORF Clone in Cloning Vector, Human HG16187-G
COPS8 cDNA ORF Clone, Human, untagged HG12404-G-N
COPS8 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12404-ACGLN
COPS8 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16187-ACGLN
COPS8 cDNA ORF Clone, Human, C-GFPSpark® tag HG16187-ACG
COPS8 cDNA ORF Clone, Human, N-GFPSpark® tag HG16187-ANG
COPS8 cDNA ORF Clone, Human, C-OFPSpark® tag HG16187-ACR
COPS8 cDNA ORF Clone, Human, N-OFPSpark® tag HG16187-ANR
COPS8 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16187-CF
COPS8 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16187-NF
COPS8 cDNA ORF Clone, Human, C-His tag HG16187-CH
COPS8 cDNA ORF Clone, Human, N-His tag HG16187-NH
COPS8 cDNA ORF Clone, Human, C-HA tag HG16187-CY
COPS8 cDNA ORF Clone, Human, N-HA tag HG16187-NY
COPS8 cDNA ORF Clone, Human, C-Myc tag HG16187-CM
COPS8 cDNA ORF Clone, Human, N-Myc tag HG16187-NM
COPS8 qPCR Primer Pairs, Human HP104761
info info
添加购物车成功! 添加购物车失败!