COMMD9 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG14570-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All COMMD9 Reagents

CRO Services

Product recommended


All COMMD9 Reagents

COMMD9 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
597 bp
Description
Full length Clone DNA of Human COMM domain containing 9 with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

COMMD9 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names

HSPC166 cDNA ORF Clone, Human

COMMD9 Background Information

COMMD9 is a COMM domain-containing or COMMD protein. COMMD family is comprised of ten members which are widely conserved throughout evolution and share certain functional properties. They represent a recently discovered set of evolutionarily conserved factors characterized by the presence of a defining carboxy-terminal motif. COMMD protein functions in the control of the transcription factor NFkappaB. NFkappaB plays a critical role in a number of homeostatic processes in multicellular organisms, including the regulation of immunity and cell survival. COMMD proteins inhibit NFkappaB mediated gene expression, and recent mechanistic studies have revealed that COMMD1 controls the ubiquitination of NFkappaB subunits, an event linked to transcriptional termination. COMMD1 binds to a multimeric ubiquitin ligase containing Elongins B/C, Cul2 and SOCS1 (ECS( SOCS1)). In this complex, COMMD1 facilitates the binding of NFkappaB subunits to the ligase, thereby promoting their ubiquitination and degradation. Additional insights gained from these studies indicate that COMMD proteins likely play a broader role in cellular homeostasis through their participation in the ubiquitination pathway.

Full Name
COMM domain containing 9
References
  • Ota T. et al., 2004, Nat Genet. 36 (1): 40-5.
  • Gerhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Burstein E. et al., 2005, J Biol Chem. 280 (23): 22222-32.
  • COMMD9 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    COMMD9 cDNA ORF Clone in Cloning Vector, Rhesus CG90377-G
    COMMD9 cDNA ORF Clone, Rhesus, untagged CG90377-UT
    COMMD9 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90377-ACG
    COMMD9 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90377-ACGLN
    COMMD9 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90377-ANG
    COMMD9 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90377-ACR
    COMMD9 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90377-ANR
    COMMD9 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90377-CF
    COMMD9 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90377-NF
    COMMD9 cDNA ORF Clone, Rhesus, C-His tag CG90377-CH
    COMMD9 cDNA ORF Clone, Rhesus, N-His tag CG90377-NH
    COMMD9 cDNA ORF Clone, Rhesus, C-HA tag CG90377-CY
    COMMD9 cDNA ORF Clone, Rhesus, N-HA tag CG90377-NY
    COMMD9 cDNA ORF Clone, Rhesus, C-Myc tag CG90377-CM
    COMMD9 cDNA ORF Clone, Rhesus, N-Myc tag CG90377-NM

    COMMD9 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    COMMD9 cDNA ORF Clone in Cloning Vector, Rat RG81303-U
    COMMD9 cDNA ORF Clone, Rat, untagged RG81303-UT
    COMMD9 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81303-ACGLN
    COMMD9 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81303-ACG
    COMMD9 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81303-ANG
    COMMD9 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81303-ACR
    COMMD9 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81303-ANR
    COMMD9 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81303-CF
    COMMD9 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81303-NF
    COMMD9 cDNA ORF Clone, Rat, C-His tag RG81303-CH
    COMMD9 cDNA ORF Clone, Rat, N-His tag RG81303-NH
    COMMD9 cDNA ORF Clone, Rat, C-HA tag RG81303-CY
    COMMD9 cDNA ORF Clone, Rat, N-HA tag RG81303-NY
    COMMD9 cDNA ORF Clone, Rat, C-Myc tag RG81303-CM
    COMMD9 cDNA ORF Clone, Rat, N-Myc tag RG81303-NM
    COMMD9 qPCR Primer Pairs, Rat RP301259

    COMMD9 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    COMMD9 cDNA ORF Clone in Cloning Vector, Mouse MG53852-U
    COMMD9 cDNA ORF Clone, Mouse, untagged MG53852-UT
    COMMD9 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53852-ACG
    COMMD9 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53852-ACGLN
    COMMD9 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53852-ANG
    COMMD9 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53852-ACR
    COMMD9 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53852-ANR
    COMMD9 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53852-CF
    COMMD9 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53852-NF
    COMMD9 cDNA ORF Clone, Mouse, C-His tag MG53852-CH
    COMMD9 cDNA ORF Clone, Mouse, N-His tag MG53852-NH
    COMMD9 cDNA ORF Clone, Mouse, C-HA tag MG53852-CY
    COMMD9 cDNA ORF Clone, Mouse, N-HA tag MG53852-NY
    COMMD9 cDNA ORF Clone, Mouse, C-Myc tag MG53852-CM
    COMMD9 cDNA ORF Clone, Mouse, N-Myc tag MG53852-NM

    COMMD9 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    COMMD9 cDNA ORF Clone in Cloning Vector, Human HG14570-G
    COMMD9 cDNA ORF Clone, Human, untagged HG14570-UT
    COMMD9 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14570-ACGLN
    COMMD9 cDNA ORF Clone, Human, C-GFPSpark® tag HG14570-ACG
    COMMD9 cDNA ORF Clone, Human, N-GFPSpark® tag HG14570-ANG
    COMMD9 cDNA ORF Clone, Human, C-OFPSpark® tag HG14570-ACR
    COMMD9 cDNA ORF Clone, Human, N-OFPSpark® tag HG14570-ANR
    COMMD9 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14570-CF
    COMMD9 cDNA ORF Clone, Human, C-His tag HG14570-CH
    COMMD9 cDNA ORF Clone, Human, N-His tag HG14570-NH
    COMMD9 cDNA ORF Clone, Human, C-HA tag HG14570-CY
    COMMD9 cDNA ORF Clone, Human, N-HA tag HG14570-NY
    COMMD9 cDNA ORF Clone, Human, C-Myc tag HG14570-CM
    COMMD9 cDNA ORF Clone, Human, N-Myc tag HG14570-NM
    COMMD9 qPCR Primer Pairs, Human HP103209
    info info
    添加购物车成功! 添加购物车失败!