Quick Order

Human COMMD8 Gene ORF cDNA clone expression plasmid, C-His tag

    DatasheetReviewsRelated ProductsProtocols
    Human COMMD8 cDNA Clone Product Information
    NCBI RefSeq:BC019826
    RefSeq ORF Size:552bp
    cDNA Description:Full length Clone DNA of Homo sapiens COMM domain containing 8 with C terminal His tag.
    Gene Synonym:COMMD8
    Species:Human
    Vector:pCMV3-C-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with COMMD8 qPCR primers for gene expression analysis, HP103300 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    Background

    COMMD8 is a member of the COMMD family. Members of this family are a group of evolutionary conserved proteins that share a common COMM domain at the extreme C-terminus, which provides an interface for protein-protein interactions. Most COMMD proteins play a role in the regulation of NF˚B and, despite their similarities, seem to function in unique and non-redundant pathways. COMMD proteins may also play a role in the function of epithelial sodium channels, cell proliferation, copper homeostasis and in the regulation of the ubiquitin pathway. COMMD8 also contains 1 COMM domain and is widely expressed with highest expression in thyroid.

    References
  • Danielsen JM. et al., 2011, Mol Cell Proteomics. 10 (3): M110.003590.
  • Vinayagam A. et al., 2011, Sci Signal. 4 (189): rs8.
  • Havugimana PC. et al., 2012, Cell. 150 (5): 1068-81.
  • Size / Price
    Catalog: HG14666-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"