Quick Order

Human COMMD8 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human COMMD8 cDNA Clone Product Information
NCBI RefSeq:BC019826
RefSeq ORF Size:552bp
cDNA Description:Full length Clone DNA of Homo sapiens COMM domain containing 8 with C terminal His tag.
Gene Synonym:COMMD8
Species:Human
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

COMMD8 is a member of the COMMD family. Members of this family are a group of evolutionary conserved proteins that share a common COMM domain at the extreme C-terminus, which provides an interface for protein-protein interactions. Most COMMD proteins play a role in the regulation of NF˚B and, despite their similarities, seem to function in unique and non-redundant pathways. COMMD proteins may also play a role in the function of epithelial sodium channels, cell proliferation, copper homeostasis and in the regulation of the ubiquitin pathway. COMMD8 also contains 1 COMM domain and is widely expressed with highest expression in thyroid.

References
  • Danielsen JM. et al., 2011, Mol Cell Proteomics. 10 (3): M110.003590.
  • Vinayagam A. et al., 2011, Sci Signal. 4 (189): rs8.
  • Havugimana PC. et al., 2012, Cell. 150 (5): 1068-81.
  • Size / Price
    Catalog: HG14666-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"