COMMD6 cDNA ORF Clone, Human, C-HA tag

Cat: HG15854-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All COMMD6 Reagents
CRO Services
Product recommended

All COMMD6 Reagents
COMMD6 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
258 bp
Description
Full length Clone DNA of Human COMM domain containing 6 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

COMMD6 cDNA ORF Clone, Human, C-HA tag Alternative Names
Acrg cDNA ORF Clone, Human
COMMD6 Background Information
Full Name
COMM domain containing 6

COMMD6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
COMMD6 cDNA ORF Clone in Cloning Vector, Mouse MG5A6045-U
COMMD6 cDNA ORF Clone, Mouse, untagged MG5A6045-UT
COMMD6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A6045-ACGLN
COMMD6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A6045-ACG
COMMD6 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A6045-ANG
COMMD6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A6045-ACR
COMMD6 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A6045-ANR
COMMD6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A6045-CF
COMMD6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A6045-NF
COMMD6 cDNA ORF Clone, Mouse, C-His tag MG5A6045-CH
COMMD6 cDNA ORF Clone, Mouse, N-His tag MG5A6045-NH
COMMD6 cDNA ORF Clone, Mouse, C-HA tag MG5A6045-CY
COMMD6 cDNA ORF Clone, Mouse, N-HA tag MG5A6045-NY
COMMD6 cDNA ORF Clone, Mouse, C-Myc tag MG5A6045-CM
COMMD6 cDNA ORF Clone, Mouse, N-Myc tag MG5A6045-NM

COMMD6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
COMMD6 cDNA ORF Clone in Cloning Vector, Human HG15854-G
COMMD6 cDNA ORF Clone, Human, untagged HG15854-UT
COMMD6 cDNA ORF Clone, Human, C-GFPSpark® tag HG15854-ACG
COMMD6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15854-ACGLN
COMMD6 cDNA ORF Clone, Human, N-GFPSpark® tag HG15854-ANG
COMMD6 cDNA ORF Clone, Human, C-OFPSpark® tag HG15854-ACR
COMMD6 cDNA ORF Clone, Human, N-OFPSpark® tag HG15854-ANR
COMMD6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15854-CF
COMMD6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15854-NF
COMMD6 cDNA ORF Clone, Human, C-His tag HG15854-CH
COMMD6 cDNA ORF Clone, Human, N-His tag HG15854-NH
COMMD6 cDNA ORF Clone, Human, N-HA tag HG15854-NY
COMMD6 cDNA ORF Clone, Human, C-Myc tag HG15854-CM
COMMD6 cDNA ORF Clone, Human, N-Myc tag HG15854-NM
COMMD6 qPCR Primer Pairs, Human HP104445
info info
添加购物车成功! 添加购物车失败!