COMMD3 cDNA ORF Clone, Human, N-His tag

Cat: HG11462-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All COMMD3 Reagents
CRO Services
Product recommended

All COMMD3 Reagents
COMMD3 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
588 bp
Description
Full length Clone DNA of Human COMM domain containing 3 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

COMMD3 cDNA ORF Clone, Human, N-His tag Alternative Names
BUP cDNA ORF Clone, Human;C10orf8 cDNA ORF Clone, Human
COMMD3 Background Information
Full Name
COMM domain containing 3

COMMD3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
COMMD3 cDNA ORF Clone in Cloning Vector, Mouse MG51260-U
COMMD3 cDNA ORF Clone, Mouse, untagged MG51260-UT
COMMD3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51260-ACG
COMMD3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51260-ACGLN
COMMD3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51260-ANG
COMMD3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51260-ACR
COMMD3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51260-ANR
COMMD3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51260-CF
COMMD3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51260-NF
COMMD3 cDNA ORF Clone, Mouse, C-His tag MG51260-CH
COMMD3 cDNA ORF Clone, Mouse, N-His tag MG51260-NH
COMMD3 cDNA ORF Clone, Mouse, C-HA tag MG51260-CY
COMMD3 cDNA ORF Clone, Mouse, N-HA tag MG51260-NY
COMMD3 cDNA ORF Clone, Mouse, C-Myc tag MG51260-CM
COMMD3 cDNA ORF Clone, Mouse, N-Myc tag MG51260-NM
COMMD3 qPCR Primer Pairs, Mouse MP201142

COMMD3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
COMMD3 cDNA ORF Clone in Cloning Vector, Human HG11462-M
COMMD3 cDNA ORF Clone, Human, untagged HG11462-UT
COMMD3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11462-ACGLN
COMMD3 cDNA ORF Clone, Human, C-GFPSpark® tag HG11462-ACG
COMMD3 cDNA ORF Clone, Human, N-GFPSpark® tag HG11462-ANG
COMMD3 cDNA ORF Clone, Human, C-OFPSpark® tag HG11462-ACR
COMMD3 cDNA ORF Clone, Human, N-OFPSpark® tag HG11462-ANR
COMMD3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11462-CF
COMMD3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11462-NF
COMMD3 cDNA ORF Clone, Human, C-His tag HG11462-CH
COMMD3 cDNA ORF Clone, Human, C-HA tag HG11462-CY
COMMD3 cDNA ORF Clone, Human, N-HA tag HG11462-NY
COMMD3 cDNA ORF Clone, Human, C-Myc tag HG11462-CM
COMMD3 cDNA ORF Clone, Human, N-Myc tag HG11462-NM
COMMD3 qPCR Primer Pairs, Human HP101339
info info
添加购物车成功! 添加购物车失败!