COMMD10 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG14008-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All COMMD10 Reagents
CRO Services
Product recommended

All COMMD10 Reagents
COMMD10 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
609 bp
Description
Full length Clone DNA of Human COMM domain containing 10 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

COMMD10 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
PTD002 cDNA ORF Clone, Human
COMMD10 Background Information
Full Name
COMM domain containing 10

COMMD10 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
COMMD10 cDNA ORF Clone in Cloning Vector, Rat RG80890-U
COMMD10 cDNA ORF Clone, Rat, untagged RG80890-UT
COMMD10 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80890-ACGLN
COMMD10 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80890-ACG
COMMD10 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80890-ANG
COMMD10 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80890-ACR
COMMD10 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80890-ANR
COMMD10 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80890-CF
COMMD10 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80890-NF
COMMD10 cDNA ORF Clone, Rat, C-His tag RG80890-CH
COMMD10 cDNA ORF Clone, Rat, N-His tag RG80890-NH
COMMD10 cDNA ORF Clone, Rat, C-HA tag RG80890-CY
COMMD10 cDNA ORF Clone, Rat, N-HA tag RG80890-NY
COMMD10 cDNA ORF Clone, Rat, C-Myc tag RG80890-CM
COMMD10 cDNA ORF Clone, Rat, N-Myc tag RG80890-NM
COMMD10 qPCR Primer Pairs, Rat RP300854

COMMD10 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
COMMD10 cDNA ORF Clone in Cloning Vector, Mouse MG51486-G
COMMD10 cDNA ORF Clone, Mouse, untagged MG51486-UT
COMMD10 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51486-ACG
COMMD10 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51486-ACGLN
COMMD10 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51486-ANG
COMMD10 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51486-ACR
COMMD10 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51486-ANR
COMMD10 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51486-CF
COMMD10 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51486-NF
COMMD10 cDNA ORF Clone, Mouse, C-His tag MG51486-CH
COMMD10 cDNA ORF Clone, Mouse, N-His tag MG51486-NH
COMMD10 cDNA ORF Clone, Mouse, C-HA tag MG51486-CY
COMMD10 cDNA ORF Clone, Mouse, N-HA tag MG51486-NY
COMMD10 cDNA ORF Clone, Mouse, C-Myc tag MG51486-CM
COMMD10 cDNA ORF Clone, Mouse, N-Myc tag MG51486-NM
COMMD10 qPCR Primer Pairs, Mouse MP201370

COMMD10 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
COMMD10 cDNA ORF Clone in Cloning Vector, Human HG14008-G
COMMD10 cDNA ORF Clone, Human, untagged HG14008-UT
COMMD10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14008-ACGLN
COMMD10 cDNA ORF Clone, Human, C-GFPSpark® tag HG14008-ACG
COMMD10 cDNA ORF Clone, Human, N-GFPSpark® tag HG14008-ANG
COMMD10 cDNA ORF Clone, Human, C-OFPSpark® tag HG14008-ACR
COMMD10 cDNA ORF Clone, Human, N-OFPSpark® tag HG14008-ANR
COMMD10 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14008-CF
COMMD10 cDNA ORF Clone, Human, C-His tag HG14008-CH
COMMD10 cDNA ORF Clone, Human, N-His tag HG14008-NH
COMMD10 cDNA ORF Clone, Human, C-HA tag HG14008-CY
COMMD10 cDNA ORF Clone, Human, N-HA tag HG14008-NY
COMMD10 cDNA ORF Clone, Human, C-Myc tag HG14008-CM
COMMD10 cDNA ORF Clone, Human, N-Myc tag HG14008-NM
COMMD10 qPCR Primer Pairs, Human HP102664
info info
添加购物车成功! 添加购物车失败!