Quick Order

Human COL4A3BP Gene ORF cDNA clone expression plasmid, N-His tag

    DatasheetReviewsRelated ProductsProtocols
    Human COL4A3BP cDNA Clone Product Information
    NCBI RefSeq:BC000102
    RefSeq ORF Size:1797bp
    cDNA Description:Full length Clone DNA of Homo sapiens collagen, type IV, alpha 3 (Goodpasture antigen) binding protein with N terminal His tag.
    Gene Synonym:CERT, CERTL, FLJ20597, GPBP, STARD11, COL4A3BP
    Species:Human
    Vector:pCMV3-N-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with COL4A3BP qPCR primers for gene expression analysis, HP102956 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    Background

    COL4A3BP is a member of the StarD2 subfamily. It contains a pleckstrin homology domain at its amino terminus and a START domain towards the end of the molecule. COL4A3BP has a lipid-binding domain that mediates intracellular trafficking of ceramide in a non-vesicular manner. One isoform of COL4A3BP is also involved in ceramide intracellular transport. COL4A3BP specifically phosphorylates the N-terminal region of the non-collagenous domain of the alpha 3 chain of type IV collagen, known as the Goodpasture antigen. An autoimmune response directed at this antigen can cause goodpasture disease.

    References
  • Rual JF, et al. (2005) Towards a proteome-scale map of the human protein-protein interaction network. Nature. 437(7062):1173-8.
  • Granero F, et al. (2005) A human-specific TNF-responsive promoter for Goodpasture antigen-binding protein. FEBS J. 272(20):5291-305.
  • Longo I, et al. (2006) Autosomal recessive Alport syndrome: an in-depth clinical and molecular analysis of five families. Nephrol Dial Transplant. 21(3):665-71.
  • Size / Price
    Catalog: HG14306-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"