Quick Order

Text Size:AAA

Human Cochlin Gene ORF cDNA clone expression plasmid, N-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human COCH cDNA Clone Product Information
NCBI RefSeq:NM_004086.2
RefSeq ORF Size:1653bp
cDNA Description:Full length Clone DNA of Homo sapiens coagulation factor C homolog, cochlin (Limulus polyphemus) with N terminal Flag tag.
Gene Synonym:DFNA9, COCH5B2, COCH-5B2, COCH
Species:Human
Vector:pCMV3-SP-N-FLAG
Plasmid:pCMV3-Flag-COCH
Restriction Site:KpnI + NotI (6kb + 1.67kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human COCH Gene Plasmid Map
Human COCH natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Cochlin, also known as COCH-5B2 and COCH, is a secreted protein which contains one LCCL domain and two VWFA domains. It is an abundant inner ear protein expressed as multiple isoforms. Its function is also unknown, but it is suspected to be an extracellular matrix component. Cochlin and type II collagen are major constituents of the inner ear extracellular matrix, and Cochlin constitutes 70% of non-collagenous protein in the inner ear, the cochlin isoforms can be classified into three subgroups, p63s, p44s and p40s. The expression of cochlin is highly specific to the inner ear. Eleven missense mutation and one in-frame deletion have been reported in the COCH gene, causing hereditary progressive sensorineural hearing loss and vestibular dysfunction, deafness autosomal dominant type 9 (DFNA9). The co-localization of cochlin and type II collagen in the fibrillar substance in the subepithelial area indicate that cochlin may play a role in the structural homeostasis of the vestibule acting in concert with the fibrillar type II collagen bundles. Defects in COCH may contribute to Meniere disease which is an autosomal dominant disorder characterized by hearing loss associated with episodic vertigo.

References
  • Ikezono T, et al. (2005) Expression of cochlin in the vestibular organ of rats. ORL J Otorhinolaryngol Relat Spec. 67(5): 252-8.
  • Shindo S, et al. (2008) Spatiotemporal expression of cochlin in the inner ear of rats during postnatal development. Neurosci Lett. 444(2): 148-52.
  • Hosokawa S, et al. (2010) Ultrastructural localization of cochlin in the rat cochlear duct. Audiol Neurootol. 15(4): 247-53.
  • Size / Price
    Catalog: HG11368-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Human COCH natural ORF mammalian expression plasmid, N-Flag tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"