COASY cDNA ORF Clone, Human, N-His tag

Cat: HG15397-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All COASY Reagents
CRO Services
Product recommended

All COASY Reagents
COASY cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1695 bp
Description
Full length Clone DNA of Human CoA synthase with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

COASY cDNA ORF Clone, Human, N-His tag Alternative Names
DPCK cDNA ORF Clone, Human;NBIA6 cDNA ORF Clone, Human;NBP cDNA ORF Clone, Human;pOV-2 cDNA ORF Clone, Human;PPAT cDNA ORF Clone, Human;UKR1 cDNA ORF Clone, Human
COASY Background Information
Full Name
CoA synthase

COASY cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
COASY cDNA ORF Clone in Cloning Vector, Cynomolgus CG90488-G
COASY cDNA ORF Clone, Cynomolgus, untagged CG90488-UT
COASY Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90488-ACGLN
COASY cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90488-ACG
COASY cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90488-ANG
COASY cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90488-ACR
COASY cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90488-ANR
COASY cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90488-CF
COASY cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90488-NF
COASY cDNA ORF Clone, Cynomolgus, C-His tag CG90488-CH
COASY cDNA ORF Clone, Cynomolgus, N-His tag CG90488-NH
COASY cDNA ORF Clone, Cynomolgus, C-HA tag CG90488-CY
COASY cDNA ORF Clone, Cynomolgus, N-HA tag CG90488-NY
COASY cDNA ORF Clone, Cynomolgus, C-Myc tag CG90488-CM
COASY cDNA ORF Clone, Cynomolgus, N-Myc tag CG90488-NM

COASY cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
COASY cDNA ORF Clone in Cloning Vector, Mouse MG5A7626-U
COASY Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7626-ACGLN

COASY cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
COASY cDNA ORF Clone in Cloning Vector, Human HG15397-G
COASY cDNA ORF Clone, Human, untagged HG15397-UT
COASY Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15397-ACGLN
COASY cDNA ORF Clone, Human, C-GFPSpark® tag HG15397-ACG
COASY cDNA ORF Clone, Human, N-GFPSpark® tag HG15397-ANG
COASY cDNA ORF Clone, Human, C-OFPSpark® tag HG15397-ACR
COASY cDNA ORF Clone, Human, N-OFPSpark® tag HG15397-ANR
COASY cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15397-CF
COASY cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15397-NF
COASY cDNA ORF Clone, Human, C-His tag HG15397-CH
COASY cDNA ORF Clone, Human, C-HA tag HG15397-CY
COASY cDNA ORF Clone, Human, N-HA tag HG15397-NY
COASY cDNA ORF Clone, Human, C-Myc tag HG15397-CM
COASY cDNA ORF Clone, Human, N-Myc tag HG15397-NM
COASY qPCR Primer Pairs, Human HP104021
info info
添加购物车成功! 添加购物车失败!