Quick Order

Text Size:AAA

Human COASY / CoA synthase Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human COASY cDNA Clone Product Information
NCBI RefSeq:BC067254
RefSeq ORF Size:1695bp
cDNA Description:Full length Clone DNA of Homo sapiens CoA synthase.
Gene Synonym:NBP, DPCK, PPAT, UKR1, pOV-2
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-COASY
Restriction Site:KpnI + XbaI (6.1kb + 1.7kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human COASY Gene Plasmid Map
Human COASY natural ORF mammalian expression plasmid
Product nameProduct name
Size / Price
Catalog: HG15397-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Bulk Discount InquiryAdd to Cart
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"