Quick Order

Human CNPY2 ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human CNPY2 cDNA Clone Product Information
NCBI RefSeq:BC065015
RefSeq ORF Size:549bp
cDNA Description:Full length Clone DNA of Homo sapiens canopy 2 homolog (zebrafish) with N terminal His tag.
Gene Synonym:UNQ1943/PRO4426, HP10390, MSAP, TMEM4, ZSIG9, CNPY2
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

CNPY2 is a novel MIR-interacting protein that enhances neurite outgrowth and increases myosin regulatory light chain. CNPY2 enhances migration of C6 glioma cells through phosphorylation of the myosin regulatory light chain. It is expressed in different tissues, including brain. Overexpression of CNPY2 enhanced the motility of glioma cells measured in matrigel invasion chambers and using a scratch assay. Downregulation of CNPY2 by RNA interference significantly decreased glioma cell migration and phosphorylation of MRLC. Inhibition of the corresponding MRLC kinase by ML-7 did not affect migration of CNPY2-overexpressing cells.

References
  • Trynka G, et al. (2009) Coeliac disease-associated risk variants in TNFAIP3 and REL implicate altered NF-kappaB signalling. Gut. 58(8):1078-83.
  • Danielsen JM, et al. (2011) Mass spectrometric analysis of lysine ubiquitylation reveals promiscuity at site level. Mol Cell Proteomics. 10(3):M110.003590.
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Size / Price
    Catalog: HG13771-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"