CMTM7 cDNA ORF Clone, Human, C-Myc tag

Cat: HG12257-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CMTM7 Reagents
CRO Services
Product recommended

All CMTM7 Reagents
CMTM7 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
528 bp
Description
Full length Clone DNA of Human CKLF-like MARVEL transmembrane domain containing 7 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CMTM7 cDNA ORF Clone, Human, C-Myc tag Alternative Names
CKLFSF7 cDNA ORF Clone, Human
CMTM7 Background Information
Full Name
CKLF-like MARVEL transmembrane domain containing 7

CMTM7 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CMTM7 cDNA ORF Clone in Cloning Vector, Mouse MG53877-U
CMTM7 cDNA ORF Clone, Mouse, untagged MG53877-UT
CMTM7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53877-ACG
CMTM7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53877-ACGLN
CMTM7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53877-ACR
CMTM7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53877-CF
CMTM7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53877-NF
CMTM7 cDNA ORF Clone, Mouse, C-His tag MG53877-CH
CMTM7 cDNA ORF Clone, Mouse, N-His tag MG53877-NH
CMTM7 cDNA ORF Clone, Mouse, C-HA tag MG53877-CY
CMTM7 cDNA ORF Clone, Mouse, N-HA tag MG53877-NY
CMTM7 cDNA ORF Clone, Mouse, C-Myc tag MG53877-CM
CMTM7 cDNA ORF Clone, Mouse, N-Myc tag MG53877-NM

CMTM7 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CMTM7 cDNA ORF Clone in Cloning Vector, Human HG12257-G
CMTM7 cDNA ORF Clone, Human, untagged HG12257-UT
CMTM7 cDNA ORF Clone, Human, C-GFPSpark® tag HG12257-ACG
CMTM7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12257-ACGLN
CMTM7 cDNA ORF Clone, Human, C-OFPSpark® tag HG12257-ACR
CMTM7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12257-CF
CMTM7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12257-NF
CMTM7 cDNA ORF Clone, Human, C-His tag HG12257-CH
CMTM7 cDNA ORF Clone, Human, N-His tag HG12257-NH
CMTM7 cDNA ORF Clone, Human, C-HA tag HG12257-CY
CMTM7 cDNA ORF Clone, Human, N-HA tag HG12257-NY
CMTM7 cDNA ORF Clone, Human, N-Myc tag HG12257-NM
CMTM7 qPCR Primer Pairs, Human HP101944
info info
添加购物车成功! 添加购物车失败!