CMTM6 cDNA ORF Clone, Human, C-Myc tag

Cat: HG11340-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CMTM6 Reagents
CRO Services
Product recommended

All CMTM6 Reagents
CMTM6 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
597 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human CKLF-like MARVEL transmembrane domain containing 6 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Restriction Sites
KpnI + XbaI(6kb+6kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
CMTM6 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CMTM6 cDNA ORF Clone, Human, C-Myc tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5611
CMTM6 cDNA ORF Clone, Human, C-Myc tag Alternative Names
CKLFSF6 cDNA ORF Clone, Human;PRO2219 cDNA ORF Clone, Human
CMTM6 Background Information
Full Name
CKLF-like MARVEL transmembrane domain containing 6

CMTM6 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CMTM6 cDNA ORF Clone in Cloning Vector, Rat RG8A1051-U
CMTM6 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A1051-ACGLN

CMTM6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CMTM6 cDNA ORF Clone in Cloning Vector, Mouse MG52931-G
CMTM6 cDNA ORF Clone, Mouse, untagged MG52931-UT
CMTM6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52931-ACG
CMTM6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52931-ACGLN
CMTM6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52931-ACR
CMTM6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52931-CF
CMTM6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52931-NF
CMTM6 cDNA ORF Clone, Mouse, C-His tag MG52931-CH
CMTM6 cDNA ORF Clone, Mouse, N-His tag MG52931-NH
CMTM6 cDNA ORF Clone, Mouse, C-HA tag MG52931-CY
CMTM6 cDNA ORF Clone, Mouse, N-HA tag MG52931-NY
CMTM6 cDNA ORF Clone, Mouse, C-Myc tag MG52931-CM
CMTM6 cDNA ORF Clone, Mouse, N-Myc tag MG52931-NM

CMTM6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CMTM6 cDNA ORF Clone in Cloning Vector, Human HG11340-M
CMTM6 cDNA ORF Clone, Human, untagged HG11340-UT
CMTM6 cDNA ORF Clone, Human, C-GFPSpark® tag HG11340-ACG
CMTM6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11340-ACGLN
CMTM6 cDNA ORF Clone, Human, N-GFPSpark® tag HG11340-ANG
CMTM6 cDNA ORF Clone, Human, C-OFPSpark® tag HG11340-ACR
CMTM6 cDNA ORF Clone, Human, N-OFPSpark® tag HG11340-ANR
CMTM6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11340-CF
CMTM6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11340-NF
CMTM6 cDNA ORF Clone, Human, C-His tag HG11340-CH
CMTM6 cDNA ORF Clone, Human, N-His tag HG11340-NH
CMTM6 cDNA ORF Clone, Human, C-HA tag HG11340-CY
CMTM6 cDNA ORF Clone, Human, N-HA tag HG11340-NY
CMTM6 cDNA ORF Clone, Human, N-Myc tag HG11340-NM
CMTM6 qPCR Primer Pairs, Human HP101225
info info
添加购物车成功! 添加购物车失败!