chymase 1 cDNA ORF Clone, Human, N-His tag

Cat: HG11482-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All chymase 1 Reagents
CRO Services
Product recommended

All chymase 1 Reagents
chymase 1 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
744 bp
Description
Full length Clone DNA of Human chymase 1, mast cell with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

chymase 1 cDNA ORF Clone, Human, N-His tag Alternative Names
chymase cDNA ORF Clone, Human;CYH cDNA ORF Clone, Human;MCT1 cDNA ORF Clone, Human
chymase 1 Background Information
Full Name
chymase 1, mast cell
References
  • Takai S, et al. (2003) Effect of chymase inhibitor on vascular proliferation. Jpn J Pharmacol. 90 (3): 223-7.
  • Caughey GH, et al. (1993) The human mast cell chymase gene (CMA1): mapping to the cathepsin G/granzyme gene cluster and lineage-restricted expression. Genomics. 15 (3): 614-20.
  • Urata H, et al. (1991) Cloning of the gene and cDNA for human heart chymase. J Biol Chem. 266 (26): 17173-9.
  • chymase 1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    chymase 1 cDNA ORF Clone, Mouse, untagged MG58858-UT
    chymase 1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58858-ACGLN
    chymase 1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58858-ACG
    chymase 1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58858-ACR
    chymase 1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58858-CF
    chymase 1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58858-NF
    chymase 1 cDNA ORF Clone, Mouse, C-His tag MG58858-CH
    chymase 1 cDNA ORF Clone, Mouse, N-His tag MG58858-NH
    chymase 1 cDNA ORF Clone, Mouse, C-HA tag MG58858-CY
    chymase 1 cDNA ORF Clone, Mouse, N-HA tag MG58858-NY
    chymase 1 cDNA ORF Clone, Mouse, C-Myc tag MG58858-CM
    chymase 1 cDNA ORF Clone, Mouse, N-Myc tag MG58858-NM

    chymase 1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    chymase 1 cDNA ORF Clone in Cloning Vector, Human HG11482-M
    chymase 1 cDNA ORF Clone, Human, untagged HG11482-UT
    chymase 1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11482-ACGLN
    chymase 1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11482-ACG
    chymase 1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11482-ACR
    chymase 1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11482-CF
    chymase 1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11482-NF
    chymase 1 cDNA ORF Clone, Human, C-His tag HG11482-CH
    chymase 1 cDNA ORF Clone, Human, C-HA tag HG11482-CY
    chymase 1 cDNA ORF Clone, Human, N-HA tag HG11482-NY
    chymase 1 cDNA ORF Clone, Human, C-Myc tag HG11482-CM
    chymase 1 cDNA ORF Clone, Human, N-Myc tag HG11482-NM
    chymase 1 qPCR Primer Pairs, Human HP101358
    info info
    添加购物车成功! 添加购物车失败!