Quick Order

Text Size:AAA

Human CMA1 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human CMA1 cDNA Clone Product Information
NCBI RefSeq:NM_001836.2
RefSeq ORF Size:744bp
cDNA Description:Full length Clone DNA of Homo sapiens chymase 1, mast cell with N terminal His tag.
Gene Synonym:CYH, MCT1, chymase, MGC119890, MGC119891, CMA1
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
References
  • Takai S, et al. (2003) Effect of chymase inhibitor on vascular proliferation. Jpn J Pharmacol. 90 (3): 223-7.
  • Caughey GH, et al. (1993) The human mast cell chymase gene (CMA1): mapping to the cathepsin G/granzyme gene cluster and lineage-restricted expression. Genomics. 15 (3): 614-20.
  • Urata H, et al. (1991) Cloning of the gene and cDNA for human heart chymase. J Biol Chem. 266 (26): 17173-9.
  • Size / Price
    Catalog: HG11482-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"