CLYBL cDNA ORF Clone, Human, C-Myc tag

Cat: HG12292-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CLYBL Reagents
CRO Services
Product recommended

All CLYBL Reagents
CLYBL cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1023 bp
Description
Full length Clone DNA of Human citrate lyase beta like with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CLYBL cDNA ORF Clone, Human, C-Myc tag Alternative Names
CLB cDNA ORF Clone, Human
CLYBL Background Information
Full Name
citrate lyase beta like

CLYBL cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CLYBL cDNA ORF Clone in Cloning Vector, Mouse MG53424-U
CLYBL cDNA ORF Clone, Mouse, untagged MG53424-UT
CLYBL Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53424-ACGLN
CLYBL cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53424-ACG
CLYBL cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53424-ANG
CLYBL cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53424-ACR
CLYBL cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53424-ANR
CLYBL cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53424-CF
CLYBL cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53424-NF
CLYBL cDNA ORF Clone, Mouse, C-His tag MG53424-CH
CLYBL cDNA ORF Clone, Mouse, N-His tag MG53424-NH
CLYBL cDNA ORF Clone, Mouse, C-HA tag MG53424-CY
CLYBL cDNA ORF Clone, Mouse, N-HA tag MG53424-NY
CLYBL cDNA ORF Clone, Mouse, C-Myc tag MG53424-CM
CLYBL cDNA ORF Clone, Mouse, N-Myc tag MG53424-NM

CLYBL cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CLYBL cDNA ORF Clone in Cloning Vector, Human HG12292-G
CLYBL cDNA ORF Clone, Human, untagged HG12292-UT
CLYBL Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12292-ACGLN
CLYBL cDNA ORF Clone, Human, C-GFPSpark® tag HG12292-ACG
CLYBL cDNA ORF Clone, Human, N-GFPSpark® tag HG12292-ANG
CLYBL cDNA ORF Clone, Human, C-OFPSpark® tag HG12292-ACR
CLYBL cDNA ORF Clone, Human, N-OFPSpark® tag HG12292-ANR
CLYBL cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12292-CF
CLYBL cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12292-NF
CLYBL cDNA ORF Clone, Human, C-His tag HG12292-CH
CLYBL cDNA ORF Clone, Human, N-His tag HG12292-NH
CLYBL cDNA ORF Clone, Human, C-HA tag HG12292-CY
CLYBL cDNA ORF Clone, Human, N-HA tag HG12292-NY
CLYBL cDNA ORF Clone, Human, N-Myc tag HG12292-NM
CLYBL qPCR Primer Pairs, Human HP101935
info info
添加购物车成功! 添加购物车失败!