clathrin light chain A cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG14036-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All clathrin light chain A Reagents
CRO Services
Product recommended

All clathrin light chain A Reagents
clathrin light chain A cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
657 bp
Description
Full length Clone DNA of Human clathrin, light chain A with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

clathrin light chain A cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
LCA cDNA ORF Clone, Human
clathrin light chain A Background Information
Full Name
clathrin, light chain A

clathrin light chain A cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
clathrin light chain A cDNA ORF Clone in Cloning Vector, Rat RG83448-U
clathrin light chain A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83448-ACGLN

clathrin light chain A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
clathrin light chain A cDNA ORF Clone in Cloning Vector, Mouse MG52109-G
clathrin light chain A cDNA ORF Clone, Mouse, untagged MG52109-UT
clathrin light chain A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52109-ACG
clathrin light chain A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52109-ACGLN
clathrin light chain A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52109-ANG
clathrin light chain A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52109-ACR
clathrin light chain A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52109-ANR
clathrin light chain A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52109-CF
clathrin light chain A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52109-NF
clathrin light chain A cDNA ORF Clone, Mouse, C-His tag MG52109-CH
clathrin light chain A cDNA ORF Clone, Mouse, N-His tag MG52109-NH
clathrin light chain A cDNA ORF Clone, Mouse, C-HA tag MG52109-CY
clathrin light chain A cDNA ORF Clone, Mouse, N-HA tag MG52109-NY
clathrin light chain A cDNA ORF Clone, Mouse, C-Myc tag MG52109-CM
clathrin light chain A cDNA ORF Clone, Mouse, N-Myc tag MG52109-NM
clathrin light chain A qPCR Primer Pairs, Mouse MP201982

clathrin light chain A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
clathrin light chain A cDNA ORF Clone in Cloning Vector, Human HG14036-G
clathrin light chain A cDNA ORF Clone, Human, untagged HG14036-UT
clathrin light chain A cDNA ORF Clone, Human, C-GFPSpark® tag HG14036-ACG
clathrin light chain A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14036-ACGLN
clathrin light chain A cDNA ORF Clone, Human, N-GFPSpark® tag HG14036-ANG
clathrin light chain A cDNA ORF Clone, Human, C-OFPSpark® tag HG14036-ACR
clathrin light chain A cDNA ORF Clone, Human, N-OFPSpark® tag HG14036-ANR
clathrin light chain A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14036-CF
clathrin light chain A cDNA ORF Clone, Human, C-His tag HG14036-CH
clathrin light chain A cDNA ORF Clone, Human, N-His tag HG14036-NH
clathrin light chain A cDNA ORF Clone, Human, C-HA tag HG14036-CY
clathrin light chain A cDNA ORF Clone, Human, N-HA tag HG14036-NY
clathrin light chain A cDNA ORF Clone, Human, C-Myc tag HG14036-CM
clathrin light chain A cDNA ORF Clone, Human, N-Myc tag HG14036-NM
clathrin light chain A qPCR Primer Pairs, Human HP102692
info info
添加购物车成功! 添加购物车失败!