CLPB cDNA ORF Clone, Human, C-HA tag

Cat: HG12212-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CLPB Reagents
CRO Services
Product recommended

All CLPB Reagents
CLPB cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2124 bp
Description
Full length Clone DNA of Human ClpB caseinolytic peptidase B homolog (E. coli) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CLPB cDNA ORF Clone, Human, C-HA tag Alternative Names
ANKCLB cDNA ORF Clone, Human;HSP78 cDNA ORF Clone, Human;MEGCANN cDNA ORF Clone, Human;MGCA7 cDNA ORF Clone, Human;SKD3 cDNA ORF Clone, Human
CLPB Background Information
Full Name
ClpB homolog, mitochondrial AAA ATPase chaperonin

CLPB cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CLPB cDNA ORF Clone in Cloning Vector, Mouse MG51533-G
CLPB cDNA ORF Clone, Mouse, untagged MG51533-UT
CLPB cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51533-ACG
CLPB Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51533-ACGLN
CLPB cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51533-ANG
CLPB cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51533-ACR
CLPB cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51533-ANR
CLPB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51533-CF
CLPB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51533-NF
CLPB cDNA ORF Clone, Mouse, C-His tag MG51533-CH
CLPB cDNA ORF Clone, Mouse, N-His tag MG51533-NH
CLPB cDNA ORF Clone, Mouse, C-HA tag MG51533-CY
CLPB cDNA ORF Clone, Mouse, N-HA tag MG51533-NY
CLPB cDNA ORF Clone, Mouse, C-Myc tag MG51533-CM
CLPB cDNA ORF Clone, Mouse, N-Myc tag MG51533-NM
CLPB qPCR Primer Pairs, Mouse MP201417

CLPB cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CLPB cDNA ORF Clone in Cloning Vector, Human HG12212-G
CLPB cDNA ORF Clone, Human, untagged HG12212-UT
CLPB cDNA ORF Clone, Human, C-GFPSpark® tag HG12212-ACG
CLPB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12212-ACGLN
CLPB cDNA ORF Clone, Human, N-GFPSpark® tag HG12212-ANG
CLPB cDNA ORF Clone, Human, C-OFPSpark® tag HG12212-ACR
CLPB cDNA ORF Clone, Human, N-OFPSpark® tag HG12212-ANR
CLPB cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12212-CF
CLPB cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12212-NF
CLPB cDNA ORF Clone, Human, C-His tag HG12212-CH
CLPB cDNA ORF Clone, Human, N-His tag HG12212-NH
CLPB cDNA ORF Clone, Human, N-HA tag HG12212-NY
CLPB cDNA ORF Clone, Human, C-Myc tag HG12212-CM
CLPB cDNA ORF Clone, Human, N-Myc tag HG12212-NM
CLPB qPCR Primer Pairs, Human HP101851
info info
添加购物车成功! 添加购物车失败!