CLK3 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG10716-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CLK3 Reagents
CRO Services
Product recommended

All CLK3 Reagents
CLK3 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1473 bp
Description
Full length Clone DNA of Human CDC-like kinase 3 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CLK3 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
PHCLK3 cDNA ORF Clone, Human;PHCLK3/152 cDNA ORF Clone, Human
CLK3 Background Information

Dual specificity protein kinase CLK3, also known as CDC-like kinase 3, and CLK3, is a member of CMGC Ser/Thr protein kinase family and Lammer subfamily. Mammalian CLK is the prototype for a family of dual specificity kinases (termed Lammer kinases) that have been conserved in evolution. CLK family members have shown to interact with, and phosphorylate, serine- and arginine-rich (SR) proteins of the spliceosomal complex, which is a part of the regulatory mechanism that enables the SR proteins to control RNA splicing. The three members of the CLK family of kinases (CLK1, CLK2, and CLK3) have been shown to undergo conserved alternative splicing to generate catalytically active and inactive isoforms. The human CLK2 and CLK3 are found within the nucleus and display dual-specificity kinase activity. The truncated isoforms, hCLK2(T) and hCLK3(T), colocalize with SR proteins in nuclear speckles. CLK3 may play a role in the development and progression of azoospermia.

Full Name
CDC-like kinase 3
References
  • Duncan, PI. et al., 1998, Exp. Cell Res. 241: 300 - 8.
  • Menegay, H. et al., 1999, Exp Cell Res. 253 (2): 463-73.
  • García-Sacristán, A. et al., 2005, Cell Res. 15 (7): 495-503.
  • Bullock, AN. et al., 2009, Structure  17 (3): 352-62.
  • CLK3 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CLK3 cDNA ORF Clone in Cloning Vector, Mouse MG5A4959-U
    CLK3 cDNA ORF Clone, Mouse, untagged MG5A4959-UT
    CLK3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4959-ACG
    CLK3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4959-ACGLN
    CLK3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A4959-ANG
    CLK3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A4959-ACR
    CLK3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A4959-ANR
    CLK3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A4959-CF
    CLK3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A4959-NF
    CLK3 cDNA ORF Clone, Mouse, C-His tag MG5A4959-CH
    CLK3 cDNA ORF Clone, Mouse, N-His tag MG5A4959-NH
    CLK3 cDNA ORF Clone, Mouse, C-HA tag MG5A4959-CY
    CLK3 cDNA ORF Clone, Mouse, N-HA tag MG5A4959-NY
    CLK3 cDNA ORF Clone, Mouse, C-Myc tag MG5A4959-CM
    CLK3 cDNA ORF Clone, Mouse, N-Myc tag MG5A4959-NM

    CLK3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CLK3 cDNA ORF Clone in Cloning Vector, Human HG10716-U
    CLK3 cDNA ORF Clone, Human, untagged HG10716-UT
    CLK3 cDNA ORF Clone, Human, C-GFPSpark® tag HG10716-ACG
    CLK3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10716-ACGLN
    CLK3 cDNA ORF Clone, Human, N-GFPSpark® tag HG10716-ANG
    CLK3 cDNA ORF Clone, Human, C-OFPSpark® tag HG10716-ACR
    CLK3 cDNA ORF Clone, Human, N-OFPSpark® tag HG10716-ANR
    CLK3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10716-CF
    CLK3 cDNA ORF Clone, Human, C-His tag HG10716-CH
    CLK3 cDNA ORF Clone, Human, N-His tag HG10716-NH
    CLK3 cDNA ORF Clone, Human, C-HA tag HG10716-CY
    CLK3 cDNA ORF Clone, Human, N-HA tag HG10716-NY
    CLK3 cDNA ORF Clone, Human, C-Myc tag HG10716-CM
    CLK3 cDNA ORF Clone, Human, N-Myc tag HG10716-NM
    CLK3 qPCR Primer Pairs, Human HP100657
    info info
    添加购物车成功! 添加购物车失败!