CLIC1 cDNA ORF Clone, Human, C-HA tag

Cat: HG15242-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CLIC1 Reagents
CRO Services
Product recommended

All CLIC1 Reagents
CLIC1 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
726 bp
Description
Full length Clone DNA of Human chloride intracellular channel 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CLIC1 cDNA ORF Clone, Human, C-HA tag Alternative Names
G6 cDNA ORF Clone, Human;NCC27 cDNA ORF Clone, Human
CLIC1 Background Information
Full Name
chloride intracellular channel 1

CLIC1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CLIC1 cDNA ORF Clone in Cloning Vector, Rat RG80807-U
CLIC1 cDNA ORF Clone, Rat, untagged RG80807-UT
CLIC1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80807-ACGLN
CLIC1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80807-ACG
CLIC1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80807-ANG
CLIC1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80807-ACR
CLIC1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80807-ANR
CLIC1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80807-CF
CLIC1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80807-NF
CLIC1 cDNA ORF Clone, Rat, C-His tag RG80807-CH
CLIC1 cDNA ORF Clone, Rat, N-His tag RG80807-NH
CLIC1 cDNA ORF Clone, Rat, C-HA tag RG80807-CY
CLIC1 cDNA ORF Clone, Rat, N-HA tag RG80807-NY
CLIC1 cDNA ORF Clone, Rat, C-Myc tag RG80807-CM
CLIC1 cDNA ORF Clone, Rat, N-Myc tag RG80807-NM
CLIC1 qPCR Primer Pairs, Rat RP300771

CLIC1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CLIC1 cDNA ORF Clone in Cloning Vector, Human HG15242-G
CLIC1 cDNA ORF Clone, Human, untagged HG15242-UT
CLIC1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15242-ACGLN
CLIC1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15242-ACG
CLIC1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15242-ACR
CLIC1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15242-CF
CLIC1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15242-NF
CLIC1 cDNA ORF Clone, Human, C-His tag HG15242-CH
CLIC1 cDNA ORF Clone, Human, N-His tag HG15242-NH
CLIC1 cDNA ORF Clone, Human, N-HA tag HG15242-NY
CLIC1 cDNA ORF Clone, Human, C-Myc tag HG15242-CM
CLIC1 cDNA ORF Clone, Human, N-Myc tag HG15242-NM
CLIC1 qPCR Primer Pairs, Human HP103868
info info
添加购物车成功! 添加购物车失败!