CLEC4D cDNA ORF Clone, Human, N-His tag

Cat: HG11485-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CLEC4D Reagents
CRO Services
Product recommended

All CLEC4D Reagents
CLEC4D cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
648 bp
Description
Full length Clone DNA of Human C-type lectin domain family 4, member D with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CLEC4D cDNA ORF Clone, Human, N-His tag Alternative Names
CLEC-6 cDNA ORF Clone, Human;CLEC6 cDNA ORF Clone, Human;CLECSF8 cDNA ORF Clone, Human;MCL cDNA ORF Clone, Human;MPCL cDNA ORF Clone, Human
CLEC4D Background Information

C-type lectin (CLEC) family is a type of carbohydrate-binding protein domain named lectin. C-type lectins are the most diverse and prevalent lectin family in immunity with its requirement for calcium for binding. Proteins including a C-type lectin domain have diverse range of functions including cell-cell adhesion, immune response to pathogens and apoptosis. There are at least 14 types of C-type lectins: typeⅠto typeⅩⅣ. CLEC4D(CLECSF8) is a typeⅡ membrane glycoprotein belonging to the C-type lectin family, with restricted expression in the monocyte/macrophage lineage. It plays important roles in the function of macrophages.

Full Name
C-type lectin domain family 4, member D
References
  • Johnson KD, et al. (2007) Friend of GATA-1-independent Transcriptional Repression: A Novel Mode of GATA-1 Function. Blood. 109 (12): 5230-3.
  • Arce I, et al. (2004) The human C-type lectin CLECSF8 is a novel monocyte/macrophage endocytic receptor. Eur J Immunol. 34 (1): 210-20.
  • Marshall AS, et al. (2006) Human MICL (CLEC12A) is differentially glycosylated and is down-regulated following cellular activation. Eur J Immunol. 36 (8): 2159-69.
  • CLEC4D cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CLEC4D cDNA ORF Clone in Cloning Vector, Rat RG80213-G
    CLEC4D cDNA ORF Clone, Rat, untagged RG80213-UT
    CLEC4D Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80213-ACGLN
    CLEC4D cDNA ORF Clone, Rat, C-GFPSpark® tag RG80213-ACG
    CLEC4D cDNA ORF Clone, Rat, C-OFPSpark® tag RG80213-ACR
    CLEC4D cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80213-CF
    CLEC4D cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80213-NF
    CLEC4D cDNA ORF Clone, Rat, C-His tag RG80213-CH
    CLEC4D cDNA ORF Clone, Rat, N-His tag RG80213-NH
    CLEC4D cDNA ORF Clone, Rat, C-HA tag RG80213-CY
    CLEC4D cDNA ORF Clone, Rat, N-HA tag RG80213-NY
    CLEC4D cDNA ORF Clone, Rat, C-Myc tag RG80213-CM
    CLEC4D cDNA ORF Clone, Rat, N-Myc tag RG80213-NM
    CLEC4D qPCR Primer Pairs, Rat RP300205

    CLEC4D cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CLEC4D cDNA ORF Clone in Cloning Vector, Mouse MG50946-G
    CLEC4D cDNA ORF Clone, Mouse, untagged MG50946-UT
    CLEC4D cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50946-ACG
    CLEC4D Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50946-ACGLN
    CLEC4D cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50946-ACR
    CLEC4D cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50946-CF
    CLEC4D cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50946-NF
    CLEC4D cDNA ORF Clone, Mouse, C-His tag MG50946-CH
    CLEC4D cDNA ORF Clone, Mouse, N-His tag MG50946-NH
    CLEC4D cDNA ORF Clone, Mouse, C-HA tag MG50946-CY
    CLEC4D cDNA ORF Clone, Mouse, N-HA tag MG50946-NY
    CLEC4D cDNA ORF Clone, Mouse, C-Myc tag MG50946-CM
    CLEC4D cDNA ORF Clone, Mouse, N-Myc tag MG50946-NM
    CLEC4D qPCR Primer Pairs, Mouse MP200915

    CLEC4D cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CLEC4D cDNA ORF Clone in Cloning Vector, Human HG11485-M
    CLEC4D cDNA ORF Clone, Human, untagged HG11485-UT
    CLEC4D cDNA ORF Clone, Human, C-GFPSpark® tag HG11485-ACG
    CLEC4D Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11485-ACGLN
    CLEC4D cDNA ORF Clone, Human, C-OFPSpark® tag HG11485-ACR
    CLEC4D cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11485-CF
    CLEC4D cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11485-NF
    CLEC4D cDNA ORF Clone, Human, C-His tag HG11485-CH
    CLEC4D cDNA ORF Clone, Human, C-HA tag HG11485-CY
    CLEC4D cDNA ORF Clone, Human, N-HA tag HG11485-NY
    CLEC4D cDNA ORF Clone, Human, C-Myc tag HG11485-CM
    CLEC4D cDNA ORF Clone, Human, N-Myc tag HG11485-NM
    CLEC4D qPCR Primer Pairs, Human HP101361
    info info
    添加购物车成功! 添加购物车失败!