Quick Order

Text Size:AAA

Human CLEC4D Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human CLEC4D cDNA Clone Product Information
NCBI RefSeq:NM_080387.4
RefSeq ORF Size:648bp
cDNA Description:Full length Clone DNA of Homo sapiens C-type lectin domain family 4, member D with N terminal Myc tag.
Gene Synonym:MCL, MPCL, CLEC6, CLEC-6, CLECSF8, MGC40078, CLEC4D
Species:Human
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

C-type lectin (CLEC) family is a type of carbohydrate-binding protein domain named lectin. C-type lectins are the most diverse and prevalent lectin family in immunity with its requirement for calcium for binding. Proteins including a C-type lectin domain have diverse range of functions including cell-cell adhesion, immune response to pathogens and apoptosis. There are at least 14 types of C-type lectins: typeⅠto typeⅩⅣ. CLEC4D(CLECSF8) is a typeⅡ membrane glycoprotein belonging to the C-type lectin family, with restricted expression in the monocyte/macrophage lineage. It plays important roles in the function of macrophages.

References
  • Johnson KD, et al. (2007) Friend of GATA-1-independent Transcriptional Repression: A Novel Mode of GATA-1 Function. Blood. 109 (12): 5230-3.
  • Arce I, et al. (2004) The human C-type lectin CLECSF8 is a novel monocyte/macrophage endocytic receptor. Eur J Immunol. 34 (1): 210-20.
  • Marshall AS, et al. (2006) Human MICL (CLEC12A) is differentially glycosylated and is down-regulated following cellular activation. Eur J Immunol. 36 (8): 2159-69.
  • Size / Price
    Catalog: HG11485-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"