CLEC-2 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10976-CF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All CLEC-2 Reagents

CRO Services

Product recommended


All CLEC-2 Reagents

CLEC-2 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
690 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human C-type lectin domain family 1, member B with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 0.73kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CLEC-2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CLEC-2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images

other Green fluorescent protein / GFP Gene Plasmid Map 5609
Human CLEC1B/CLEC2 Gene Expression validated Image 14183
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

CLEC-2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names

1810061I13Rik cDNA ORF Clone, Human;CLEC2 cDNA ORF Clone, Human;CLEC2B cDNA ORF Clone, Human;PRO1384 cDNA ORF Clone, Human;QDED721 cDNA ORF Clone, Human

CLEC-2 Background Information

CLEC1B, also known as CLEC2, is a C-type lectin-like receptor expressed in myeloid cells and NK cells. Natural killer (NK) cells express multiple calcium-dependent (C-type) lectin-like receptors, such as CD94 and NKG2D, that interact with major histocompatibility complex class I molecules and either inhibit or activate cytotoxicity and cytokine secretion. CLEC2 acts as a receptor for the platelet-aggregating snake venom protein rhodocytin. Rhodocytin binding leads to tyrosine phosphorylation and this promotes the binding of spleen tyrosine kinase (Syk) and initiation of downstream tyrosine phosphorylation events and activation of PLC-gamma-2. CLEC2 contains 1 C-type lectin domain and is expressed preferentially in the liver. It acts as an attachment factor for human immunodeficiency virus type 1 (HIV-1) and facilitates its capture by platelets.

Full Name
C-type lectin domain family 1, member B
References
  • Suzuki-Inoue K, et al. (2007) Involvement of the snake toxin receptor CLEC-2, in podoplanin-mediated platelet activation, by cancer cells. J Biol Chem. 282(36):25993-6001.
  • Watson AA, et al. (2007) The crystal structure and mutational binding analysis of the extracellular domain of the platelet-activating receptor CLEC-2. J Biol Chem. 282(5):3165-72.
  • Chaipan C, et al. (2006) DC-SIGN and CLEC-2 mediate human immunodeficiency virus type 1 capture by platelets. J Virol. 80(18):8951-60.
  • CLEC-2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CLEC-2 cDNA ORF Clone in Cloning Vector, Mouse MG50306-M
    CLEC-2 cDNA ORF Clone, Mouse, untagged MG50306-UT
    CLEC-2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50306-ACGLN
    CLEC-2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50306-ACG
    CLEC-2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50306-ACR
    CLEC-2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50306-CF
    CLEC-2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50306-NF
    CLEC-2 cDNA ORF Clone, Mouse, C-His tag MG50306-CH
    CLEC-2 cDNA ORF Clone, Mouse, N-His tag MG50306-NH
    CLEC-2 cDNA ORF Clone, Mouse, C-HA tag MG50306-CY
    CLEC-2 cDNA ORF Clone, Mouse, N-HA tag MG50306-NY
    CLEC-2 cDNA ORF Clone, Mouse, C-Myc tag MG50306-CM
    CLEC-2 cDNA ORF Clone, Mouse, N-Myc tag MG50306-NM
    CLEC-2 qPCR Primer Pairs, Mouse MP200329

    CLEC-2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CLEC-2 cDNA ORF Clone in Cloning Vector, Human HG10976-M
    CLEC-2 cDNA ORF Clone, Human, untagged HG10976-UT
    CLEC-2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10976-ACG
    CLEC-2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10976-ACGLN
    CLEC-2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10976-ACR
    CLEC-2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10976-NF
    CLEC-2 cDNA ORF Clone, Human, C-His tag HG10976-CH
    CLEC-2 cDNA ORF Clone, Human, N-His tag HG10976-NH
    CLEC-2 cDNA ORF Clone, Human, C-HA tag HG10976-CY
    CLEC-2 cDNA ORF Clone, Human, N-HA tag HG10976-NY
    CLEC-2 cDNA ORF Clone, Human, C-Myc tag HG10976-CM
    CLEC-2 cDNA ORF Clone, Human, N-Myc tag HG10976-NM
    CLEC-2 qPCR Primer Pairs, Human HP100941
    info info
    添加购物车成功! 添加购物车失败!