CLEC-1 cDNA ORF Clone, Human, C-HA tag

Cat: HG12149-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CLEC-1 Reagents
CRO Services
Product recommended

All CLEC-1 Reagents
CLEC-1 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
843 bp
Description
Full length Clone DNA of Human C-type lectin domain family 1, member A with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CLEC-1 cDNA ORF Clone, Human, C-HA tag Alternative Names
CLEC-1 cDNA ORF Clone, Human;CLEC1 cDNA ORF Clone, Human
CLEC-1 Background Information

CLEC1A, also known as CLEC-1, is a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. CLEC1A contains 1 C-type lectin domain and is expressed preferentially in dendritic cells. It may play a role in regulating dendritic cell function. CLEC1A gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. Alternative splice variants have been described but their biological nature has not been determined. CLEC1A is found to be not only expressed in dendritic cells, but also in endothelial cells and in the latter aspect resembles the LOX-1 gene.

Full Name
C-type lectin domain family 1, member A
References
  • Ebner S, et al. (2003) volutionary analysis reveals collective properties and specificity in the C-type lectin and lectin-like domain superfamily. Proteins. 53(1):44-55.
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Drickamer K. (1999) C-type lectin-like domains. Curr Opin Struct Biol. 9(5):585-90.
  • CLEC-1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CLEC-1 cDNA ORF Clone in Cloning Vector, Rat RG80212-G
    CLEC-1 cDNA ORF Clone, Rat, untagged RG80212-UT
    CLEC-1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80212-ACGLN
    CLEC-1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80212-ACG
    CLEC-1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80212-ACR
    CLEC-1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80212-CF
    CLEC-1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80212-NF
    CLEC-1 cDNA ORF Clone, Rat, C-His tag RG80212-CH
    CLEC-1 cDNA ORF Clone, Rat, N-His tag RG80212-NH
    CLEC-1 cDNA ORF Clone, Rat, C-HA tag RG80212-CY
    CLEC-1 cDNA ORF Clone, Rat, N-HA tag RG80212-NY
    CLEC-1 cDNA ORF Clone, Rat, C-Myc tag RG80212-CM
    CLEC-1 cDNA ORF Clone, Rat, N-Myc tag RG80212-NM
    CLEC-1 qPCR Primer Pairs, Rat RP300204

    CLEC-1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CLEC-1 cDNA ORF Clone in Cloning Vector, Mouse MG50307-M
    CLEC-1 cDNA ORF Clone, Mouse, untagged MG50307-UT
    CLEC-1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50307-ACGLN
    CLEC-1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50307-ACG
    CLEC-1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50307-ACR
    CLEC-1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50307-CF
    CLEC-1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50307-NF
    CLEC-1 cDNA ORF Clone, Mouse, C-His tag MG50307-CH
    CLEC-1 cDNA ORF Clone, Mouse, N-His tag MG50307-NH
    CLEC-1 cDNA ORF Clone, Mouse, C-HA tag MG50307-CY
    CLEC-1 cDNA ORF Clone, Mouse, N-HA tag MG50307-NY
    CLEC-1 cDNA ORF Clone, Mouse, C-Myc tag MG50307-CM
    CLEC-1 cDNA ORF Clone, Mouse, N-Myc tag MG50307-NM
    CLEC-1 qPCR Primer Pairs, Mouse MP200330

    CLEC-1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CLEC-1 cDNA ORF Clone in Cloning Vector, Human HG12149-G
    CLEC-1 cDNA ORF Clone, Human, untagged HG12149-UT
    CLEC-1 cDNA ORF Clone, Human, C-GFPSpark® tag HG12149-ACG
    CLEC-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12149-ACGLN
    CLEC-1 cDNA ORF Clone, Human, C-OFPSpark® tag HG12149-ACR
    CLEC-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12149-CF
    CLEC-1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12149-NF
    CLEC-1 cDNA ORF Clone, Human, C-His tag HG12149-CH
    CLEC-1 cDNA ORF Clone, Human, N-His tag HG12149-NH
    CLEC-1 cDNA ORF Clone, Human, N-HA tag HG12149-NY
    CLEC-1 cDNA ORF Clone, Human, C-Myc tag HG12149-CM
    CLEC-1 cDNA ORF Clone, Human, N-Myc tag HG12149-NM
    CLEC-1 qPCR Primer Pairs, Human HP101806
    info info
    添加购物车成功! 添加购物车失败!