After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human CLEC1A / CLEC-1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human CLEC1A cDNA Clone Product Information
NCBI RefSeq:BC039072
RefSeq ORF Size:843bp
cDNA Description:Full length Clone DNA of Homo sapiens C-type lectin domain family 1, member A.
Gene Synonym:CLEC1, MGC34328, CLEC1A
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-CLEC1A
Restriction Site:KpnI + XbaI (6.1kb + 0.84kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CLEC1A Gene Plasmid Map
Human CLEC1A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Background

CLEC1A, also known as CLEC-1, is a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. CLEC1A contains 1 C-type lectin domain and is expressed preferentially in dendritic cells. It may play a role in regulating dendritic cell function. CLEC1A gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. Alternative splice variants have been described but their biological nature has not been determined. CLEC1A is found to be not only expressed in dendritic cells, but also in endothelial cells and in the latter aspect resembles the LOX-1 gene.

References
  • Ebner S, et al. (2003) volutionary analysis reveals collective properties and specificity in the C-type lectin and lectin-like domain superfamily. Proteins. 53(1):44-55.
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Drickamer K. (1999) C-type lectin-like domains. Curr Opin Struct Biol. 9(5):585-90.
  • Size / Price
    Catalog: HG12149-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Human CLEC1A Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"