After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human CLEC1A / CLEC-1 Gene ORF cDNA clone expression plasmid, N-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human CLEC1A cDNA Clone Product Information
NCBI RefSeq:BC039072
RefSeq ORF Size:843bp
cDNA Description:Full length Clone DNA of Homo sapiens C-type lectin domain family 1, member A with N terminal Flag tag.
Gene Synonym:CLEC1, MGC34328, CLEC1A
Species:Human
Vector:pCMV3-SP-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

CLEC1A, also known as CLEC-1, is a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. CLEC1A contains 1 C-type lectin domain and is expressed preferentially in dendritic cells. It may play a role in regulating dendritic cell function. CLEC1A gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. Alternative splice variants have been described but their biological nature has not been determined. CLEC1A is found to be not only expressed in dendritic cells, but also in endothelial cells and in the latter aspect resembles the LOX-1 gene.

References
  • Ebner S, et al. (2003) volutionary analysis reveals collective properties and specificity in the C-type lectin and lectin-like domain superfamily. Proteins. 53(1):44-55.
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Drickamer K. (1999) C-type lectin-like domains. Curr Opin Struct Biol. 9(5):585-90.
  • Size / Price
    Catalog: HG12149-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"