CLEC10A cDNA ORF Clone, Human, N-Myc tag

Cat: HG10821-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CLEC10A Reagents
CRO Services
Product recommended

All CLEC10A Reagents
CLEC10A cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
879 bp
Description
Full length Clone DNA of Human C-type lectin domain family 10, member A , transcript variant 2 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CLEC10A cDNA ORF Clone, Human, N-Myc tag Alternative Names
CD301 cDNA ORF Clone, Human;CLECSF13 cDNA ORF Clone, Human;CLECSF14 cDNA ORF Clone, Human;HML cDNA ORF Clone, Human;HML2 cDNA ORF Clone, Human;MGL cDNA ORF Clone, Human
CLEC10A Background Information

CLEC10A, also known as the macrophage galactose-type calcium-type lectins (MGLs; CD301) constitute a unique class of C-type lectins because of their specificity for galactose and its structural homologues. MGLs/CD301 is a type II transmembrane glycoproteins and is expressed on macrophages and related cells of myeloid origins, particularly immature dendritic cells (DCs). There are 2 homologues: MGL1 and MGL2 (CD301a and CD301b) in mice. MGL1/CD301a induces both the production and secretion of interleukin (IL)-10. MGL1/CD301a plays a protective role against colitis by effectively inducing IL-10 production by colonic lamina propria macrophages in response to invading commensal bacteria.

Full Name
C-type lectin domain family 10, member A
References
  • Saba K, et al. (2009) A C-type lectin MGL1/CD301a plays an anti-inflammatory role in murine experimental colitis. Am J Pathol. 174(1): 144-52.
  • Suzuki N, et al. (2002) Molecular cloning and expression of cDNA encoding human macrophage C-type lectin: its unique carbohydrate binding specificity for Tn antigen. J Immunol. 1996 ;156: 128-135.
  • Tsuiji M, et al. (2002) Molecular cloning and characterization of a novel mouse macrophage C-type lectin, mMGL2, which has a distinct carbohydrate specificity from mMGL1. J Biol Chem. 277: 28892-28901.
  • Denda-Nagai K, et al. (2002) Macrophage C-type lectin on bone marrow-derived immature dendritic cells is involved in the internalization of glycosylated antigens. Glycobiology. 12: 443-450.
  • CLEC10A cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CLEC10A cDNA ORF Clone in Cloning Vector, Rat RG80210-U
    CLEC10A cDNA ORF Clone, Rat, untagged RG80210-UT
    CLEC10A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80210-ACGLN
    CLEC10A cDNA ORF Clone, Rat, C-GFPSpark® tag RG80210-ACG
    CLEC10A cDNA ORF Clone, Rat, C-OFPSpark® tag RG80210-ACR
    CLEC10A cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80210-CF
    CLEC10A cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80210-NF
    CLEC10A cDNA ORF Clone, Rat, C-His tag RG80210-CH
    CLEC10A cDNA ORF Clone, Rat, N-His tag RG80210-NH
    CLEC10A cDNA ORF Clone, Rat, C-HA tag RG80210-CY
    CLEC10A cDNA ORF Clone, Rat, N-HA tag RG80210-NY
    CLEC10A cDNA ORF Clone, Rat, C-Myc tag RG80210-CM
    CLEC10A cDNA ORF Clone, Rat, N-Myc tag RG80210-NM
    CLEC10A qPCR Primer Pairs, Rat RP300202

    CLEC10A cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CLEC10A cDNA ORF Clone in Cloning Vector, Mouse MG50707-M
    CLEC10A cDNA ORF Clone, Mouse, untagged MG50707-UT
    CLEC10A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50707-ACG
    CLEC10A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50707-ACGLN
    CLEC10A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50707-ACR
    CLEC10A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50707-CF
    CLEC10A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50707-NF
    CLEC10A cDNA ORF Clone, Mouse, C-His tag MG50707-CH
    CLEC10A cDNA ORF Clone, Mouse, N-His tag MG50707-NH
    CLEC10A cDNA ORF Clone, Mouse, C-HA tag MG50707-CY
    CLEC10A cDNA ORF Clone, Mouse, N-HA tag MG50707-NY
    CLEC10A cDNA ORF Clone, Mouse, C-Myc tag MG50707-CM
    CLEC10A cDNA ORF Clone, Mouse, N-Myc tag MG50707-NM
    CLEC10A qPCR Primer Pairs, Mouse MP200682

    CLEC10A cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CLEC10A cDNA ORF Clone in Cloning Vector, Human HG10821-M
    CLEC10A cDNA ORF Clone, Human, untagged HG10821-UT
    CLEC10A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10821-ACGLN
    CLEC10A cDNA ORF Clone, Human, C-GFPSpark® tag HG10821-ACG
    CLEC10A cDNA ORF Clone, Human, C-OFPSpark® tag HG10821-ACR
    CLEC10A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10821-CF
    CLEC10A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10821-NF
    CLEC10A cDNA ORF Clone, Human, C-His tag HG10821-CH
    CLEC10A cDNA ORF Clone, Human, N-His tag HG10821-NH
    CLEC10A cDNA ORF Clone, Human, C-HA tag HG10821-CY
    CLEC10A cDNA ORF Clone, Human, N-HA tag HG10821-NY
    CLEC10A cDNA ORF Clone, Human, C-Myc tag HG10821-CM
    CLEC10A qPCR Primer Pairs, Human HP100725
    info info
    添加购物车成功! 添加购物车失败!