Claudin 7 cDNA ORF Clone, Human, N-His tag

Cat: HG11455-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Claudin 7 Reagents
CRO Services
Product recommended

All Claudin 7 Reagents
Claudin 7 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
636 bp
Description
Full length Clone DNA of Human claudin 7 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Claudin 7 cDNA ORF Clone, Human, N-His tag Alternative Names
CEPTRL2 cDNA ORF Clone, Human;claudin-1 cDNA ORF Clone, Human;CLDN-7 cDNA ORF Clone, Human;CPETRL2 cDNA ORF Clone, Human;Hs.84359 cDNA ORF Clone, Human
Claudin 7 Background Information
Full Name
claudin 7

Claudin 7 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Claudin 7 cDNA ORF Clone in Cloning Vector, Mouse MG58980-U
Claudin 7 cDNA ORF Clone, Mouse, untagged MG58980-UT
Claudin 7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58980-ACGLN
Claudin 7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58980-ACG
Claudin 7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58980-ACR
Claudin 7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58980-CF
Claudin 7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58980-NF
Claudin 7 cDNA ORF Clone, Mouse, C-His tag MG58980-CH
Claudin 7 cDNA ORF Clone, Mouse, N-His tag MG58980-NH
Claudin 7 cDNA ORF Clone, Mouse, C-HA tag MG58980-CY
Claudin 7 cDNA ORF Clone, Mouse, N-HA tag MG58980-NY
Claudin 7 cDNA ORF Clone, Mouse, C-Myc tag MG58980-CM
Claudin 7 cDNA ORF Clone, Mouse, N-Myc tag MG58980-NM

Claudin 7 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Claudin 7 cDNA ORF Clone in Cloning Vector, Human HG11455-M
Claudin 7 cDNA ORF Clone, Human, untagged HG11455-UT
Claudin 7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11455-ACGLN
Claudin 7 cDNA ORF Clone, Human, C-GFPSpark® tag HG11455-ACG
Claudin 7 cDNA ORF Clone, Human, C-OFPSpark® tag HG11455-ACR
Claudin 7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11455-CF
Claudin 7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11455-NF
Claudin 7 cDNA ORF Clone, Human, C-His tag HG11455-CH
Claudin 7 cDNA ORF Clone, Human, C-HA tag HG11455-CY
Claudin 7 cDNA ORF Clone, Human, N-HA tag HG11455-NY
Claudin 7 cDNA ORF Clone, Human, C-Myc tag HG11455-CM
Claudin 7 cDNA ORF Clone, Human, N-Myc tag HG11455-NM
Claudin 7 qPCR Primer Pairs, Human HP101332
info info
添加购物车成功! 添加购物车失败!