Claudin 10 cDNA ORF Clone, Human, N-Myc tag

Cat: HG13880-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Claudin 10 Reagents
CRO Services
Product recommended

All Claudin 10 Reagents
Claudin 10 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
687 bp
Description
Full length Clone DNA of Human claudin 10 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Claudin 10 cDNA ORF Clone, Human, N-Myc tag Alternative Names
CPETRL3 cDNA ORF Clone, Human;OSP-L cDNA ORF Clone, Human
Claudin 10 Background Information
Full Name
claudin 10

Claudin 10 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Claudin 10 cDNA ORF Clone in Cloning Vector, Mouse MG5A0152-U
Claudin 10 cDNA ORF Clone, Mouse, untagged MG5A0152-UT
Claudin 10 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0152-ACG
Claudin 10 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0152-ACGLN
Claudin 10 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A0152-ACR
Claudin 10 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A0152-CF
Claudin 10 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A0152-NF
Claudin 10 cDNA ORF Clone, Mouse, C-His tag MG5A0152-CH
Claudin 10 cDNA ORF Clone, Mouse, N-His tag MG5A0152-NH
Claudin 10 cDNA ORF Clone, Mouse, C-HA tag MG5A0152-CY
Claudin 10 cDNA ORF Clone, Mouse, N-HA tag MG5A0152-NY
Claudin 10 cDNA ORF Clone, Mouse, C-Myc tag MG5A0152-CM
Claudin 10 cDNA ORF Clone, Mouse, N-Myc tag MG5A0152-NM

Claudin 10 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Claudin 10 cDNA ORF Clone in Cloning Vector, Human HG13880-G
Claudin 10 cDNA ORF Clone, Human, untagged HG13880-UT
Claudin 10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13880-ACGLN
Claudin 10 cDNA ORF Clone, Human, C-GFPSpark® tag HG13880-ACG
Claudin 10 cDNA ORF Clone, Human, C-OFPSpark® tag HG13880-ACR
Claudin 10 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13880-CF
Claudin 10 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13880-NF
Claudin 10 cDNA ORF Clone, Human, C-His tag HG13880-CH
Claudin 10 cDNA ORF Clone, Human, N-His tag HG13880-NH
Claudin 10 cDNA ORF Clone, Human, C-HA tag HG13880-CY
Claudin 10 cDNA ORF Clone, Human, N-HA tag HG13880-NY
Claudin 10 cDNA ORF Clone, Human, C-Myc tag HG13880-CM
Claudin 10 qPCR Primer Pairs, Human HP102549
info info
添加购物车成功! 添加购物车失败!