CKS1 cDNA ORF Clone, Human, C-His tag

Cat: HG16359-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CKS1 Reagents
CRO Services
Product recommended

All CKS1 Reagents
CKS1 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
240 bp
Description
Full length Clone DNA of Human CDC28 protein kinase regulatory subunit 1B with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CKS1 cDNA ORF Clone, Human, C-His tag Alternative Names
CKS1 cDNA ORF Clone, Human;ckshs1 cDNA ORF Clone, Human;PNAS-16 cDNA ORF Clone, Human;PNAS-18 cDNA ORF Clone, Human
CKS1 Background Information
Full Name
CDC28 protein kinase regulatory subunit 1B

CKS1 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
CKS1 cDNA ORF Clone in Cloning Vector, Ferret FG60120-G
CKS1 cDNA ORF Clone, Ferret, untagged FG60120-UT
CKS1 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60120-ACGLN
CKS1 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60120-ACG
CKS1 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60120-ANG
CKS1 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60120-ACR
CKS1 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60120-ANR
CKS1 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60120-CF
CKS1 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60120-NF
CKS1 cDNA ORF Clone, Ferret, C-His tag FG60120-CH
CKS1 cDNA ORF Clone, Ferret, N-His tag FG60120-NH
CKS1 cDNA ORF Clone, Ferret, C-HA tag FG60120-CY
CKS1 cDNA ORF Clone, Ferret, N-HA tag FG60120-NY
CKS1 cDNA ORF Clone, Ferret, C-Myc tag FG60120-CM
CKS1 cDNA ORF Clone, Ferret, N-Myc tag FG60120-NM

CKS1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CKS1 cDNA ORF Clone in Cloning Vector, Rat RG80766-U
CKS1 cDNA ORF Clone, Rat, untagged RG80766-UT
CKS1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80766-ACGLN
CKS1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80766-ACG
CKS1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80766-ANG
CKS1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80766-ACR
CKS1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80766-ANR
CKS1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80766-CF
CKS1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80766-NF
CKS1 cDNA ORF Clone, Rat, C-His tag RG80766-CH
CKS1 cDNA ORF Clone, Rat, N-His tag RG80766-NH
CKS1 cDNA ORF Clone, Rat, C-HA tag RG80766-CY
CKS1 cDNA ORF Clone, Rat, N-HA tag RG80766-NY
CKS1 cDNA ORF Clone, Rat, C-Myc tag RG80766-CM
CKS1 cDNA ORF Clone, Rat, N-Myc tag RG80766-NM

CKS1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CKS1 cDNA ORF Clone in Cloning Vector, Mouse MG52789-G
CKS1 cDNA ORF Clone, Mouse, untagged MG52789-UT
CKS1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52789-ACG
CKS1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52789-ACGLN
CKS1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52789-ANG
CKS1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52789-ACR
CKS1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52789-ANR
CKS1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52789-CF
CKS1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52789-NF
CKS1 cDNA ORF Clone, Mouse, C-His tag MG52789-CH
CKS1 cDNA ORF Clone, Mouse, N-His tag MG52789-NH
CKS1 cDNA ORF Clone, Mouse, C-HA tag MG52789-CY
CKS1 cDNA ORF Clone, Mouse, N-HA tag MG52789-NY
CKS1 cDNA ORF Clone, Mouse, C-Myc tag MG52789-CM
CKS1 cDNA ORF Clone, Mouse, N-Myc tag MG52789-NM

CKS1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CKS1 cDNA ORF Clone in Cloning Vector, Human HG16359-G
CKS1 cDNA ORF Clone, Human, untagged HG16359-UT
CKS1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16359-ACGLN
CKS1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16359-ACG
CKS1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16359-ANG
CKS1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16359-ACR
CKS1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16359-ANR
CKS1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16359-CF
CKS1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16359-NF
CKS1 cDNA ORF Clone, Human, N-His tag HG16359-NH
CKS1 cDNA ORF Clone, Human, C-HA tag HG16359-CY
CKS1 cDNA ORF Clone, Human, N-HA tag HG16359-NY
CKS1 cDNA ORF Clone, Human, C-Myc tag HG16359-CM
CKS1 cDNA ORF Clone, Human, N-Myc tag HG16359-NM
CKS1 qPCR Primer Pairs, Human HP105110
info info
添加购物车成功! 添加购物车失败!