Quick Order

Human CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human CIRBP cDNA Clone Product Information
NCBI RefSeq:BC000403
RefSeq ORF Size:519bp
cDNA Description:Full length Clone DNA of Homo sapiens cold inducible RNA binding protein.
Gene Synonym:CIRP
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid on other vectors
Human CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG14578-ACG$225
Human CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG14578-ACR$225
Human CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG14578-ANG$225
Human CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG14578-ANR$225
Human CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, C-Flag tagHG14578-CF$195
Human CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, C-His tagHG14578-CH$195
Human CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, C-Myc tagHG14578-CM$195
Human CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, C-HA tagHG14578-CY$195
Human CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone in cloning vectorHG14578-G$75
Human CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, N-Flag tagHG14578-NF$195
Human CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, N-His tagHG14578-NH$195
Human CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, N-Myc tagHG14578-NM$195
Human CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, N-HA tagHG14578-NY$195
Human CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmidHG14578-UT$195
 Learn more about expression Vectors
Product nameProduct name
Background

CIRBP, also known as cold-inducible RNA-binding protein, plays a protective role in the genotoxic stress response by stabilizing transcripts of genes involved in cell survival. CIRBP responds to a wide array of cellular stresses, including short wavelength ultraviolet light (UVC), at the transcriptional and post-translational level. It acts as a translational activator.CIRBP can bind the 3 translated region of specific transcripts to stabilize them and facilitate their transport to ribosomes for translation. CIRBP affects NF-κB signaling as opposed to IL1B mRNA stability directly.

References
  • Artero-Castro A. et al., 2009, Mol Cell Biol. 29 (7): 1855-68.
  • Zeng Y. et al., 2009, J Cell Biochem. 107 (1): 179-88.
  • Brochu C. et al., 2013, PLoS One. 8 (2): e57426.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"