Quick Order

Human CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, N-Flag tag

    DatasheetReviewsRelated ProductsProtocols
    Human CIRBP cDNA Clone Product Information
    NCBI RefSeq:BC000403
    RefSeq ORF Size:519bp
    cDNA Description:Full length Clone DNA of Homo sapiens cold inducible RNA binding protein with N terminal Flag tag.
    Gene Synonym:CIRP
    Species:Human
    Vector:pCMV3-N-FLAG
    Plasmid:
    Restriction Site:
    Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CIRBP qPCR primers for gene expression analysis, HP103214 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Human CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, N-Flag tag on other vectors
    Human CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG14578-ACG$225
    Human CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG14578-ACR$225
    Human CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG14578-ANG$225
    Human CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG14578-ANR$225
    Human CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, C-Flag tagHG14578-CF$195
    Human CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, C-His tagHG14578-CH$195
    Human CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, C-Myc tagHG14578-CM$195
    Human CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, C-HA tagHG14578-CY$195
    Human CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone in cloning vectorHG14578-G$75
    Human CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, N-Flag tagHG14578-NF$195
    Human CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, N-His tagHG14578-NH$195
    Human CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, N-Myc tagHG14578-NM$195
    Human CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmid, N-HA tagHG14578-NY$195
    Human CIRBP / Cold-inducible RNA-binding Protein Gene ORF cDNA clone expression plasmidHG14578-UT$195
     Learn more about expression Vectors
    Product nameProduct name
    Background

    CIRBP, also known as cold-inducible RNA-binding protein, plays a protective role in the genotoxic stress response by stabilizing transcripts of genes involved in cell survival. CIRBP responds to a wide array of cellular stresses, including short wavelength ultraviolet light (UVC), at the transcriptional and post-translational level. It acts as a translational activator.CIRBP can bind the 3 translated region of specific transcripts to stabilize them and facilitate their transport to ribosomes for translation. CIRBP affects NF-κB signaling as opposed to IL1B mRNA stability directly.

    References
  • Artero-Castro A. et al., 2009, Mol Cell Biol. 29 (7): 1855-68.
  • Zeng Y. et al., 2009, J Cell Biochem. 107 (1): 179-88.
  • Brochu C. et al., 2013, PLoS One. 8 (2): e57426.
  • Size / Price
    Catalog: HG14578-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"