CHST12 cDNA ORF Clone, Human, N-His tag

Cat: HG12308-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All CHST12 Reagents

CRO Services

Product recommended


All CHST12 Reagents

CHST12 cDNA ORF Clone, Human, N-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1245 bp
Description
Full length Clone DNA of Human carbohydrate (chondroitin 4) sulfotransferase 12 with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CHST12 cDNA ORF Clone, Human, N-His tag Alternative Names

C4S-2 cDNA ORF Clone, Human;C4ST-2 cDNA ORF Clone, Human;C4ST2 cDNA ORF Clone, Human

CHST12 Background Information

Full Name
carbohydrate (chondroitin 4) sulfotransferase 12

CHST12 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CHST12 cDNA ORF Clone in Cloning Vector, Mouse MG53301-U
CHST12 cDNA ORF Clone, Mouse, untagged MG53301-UT
CHST12 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53301-ACG
CHST12 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53301-ACGLN
CHST12 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53301-ACR
CHST12 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53301-CF
CHST12 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53301-NF
CHST12 cDNA ORF Clone, Mouse, C-His tag MG53301-CH
CHST12 cDNA ORF Clone, Mouse, N-His tag MG53301-NH
CHST12 cDNA ORF Clone, Mouse, C-HA tag MG53301-CY
CHST12 cDNA ORF Clone, Mouse, N-HA tag MG53301-NY
CHST12 cDNA ORF Clone, Mouse, C-Myc tag MG53301-CM
CHST12 cDNA ORF Clone, Mouse, N-Myc tag MG53301-NM

CHST12 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CHST12 cDNA ORF Clone in Cloning Vector, Human HG12308-G
CHST12 cDNA ORF Clone, Human, untagged HG12308-UT
CHST12 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12308-ACGLN
CHST12 cDNA ORF Clone, Human, C-GFPSpark® tag HG12308-ACG
CHST12 cDNA ORF Clone, Human, C-OFPSpark® tag HG12308-ACR
CHST12 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12308-CF
CHST12 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12308-NF
CHST12 cDNA ORF Clone, Human, C-His tag HG12308-CH
CHST12 cDNA ORF Clone, Human, C-HA tag HG12308-CY
CHST12 cDNA ORF Clone, Human, N-HA tag HG12308-NY
CHST12 cDNA ORF Clone, Human, C-Myc tag HG12308-CM
CHST12 cDNA ORF Clone, Human, N-Myc tag HG12308-NM
CHST12 qPCR Primer Pairs, Human HP101940
info info
添加购物车成功! 添加购物车失败!