CHST1 cDNA ORF Clone, Human, N-His tag

Cat: HG12306-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All CHST1 Reagents

CRO Services

Product recommended


All CHST1 Reagents

CHST1 cDNA ORF Clone, Human, N-His tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
1236 bp
Description
Full length Clone DNA of Human carbohydrate (keratan sulfate Gal-6) sulfotransferase 1 with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CHST1 cDNA ORF Clone, Human, N-His tag Alternative Names

C6ST cDNA ORF Clone, Human;GST-1 cDNA ORF Clone, Human;KS6ST cDNA ORF Clone, Human;KSGal6ST cDNA ORF Clone, Human;KSST cDNA ORF Clone, Human

CHST1 Background Information

Full Name
carbohydrate (keratan sulfate Gal-6) sulfotransferase 1

CHST1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CHST1 cDNA ORF Clone in Cloning Vector, Mouse MG50561-M
CHST1 cDNA ORF Clone, Mouse, untagged MG50561-UT
CHST1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50561-ACGLN
CHST1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50561-ACG
CHST1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50561-ACR
CHST1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50561-CF
CHST1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50561-NF
CHST1 cDNA ORF Clone, Mouse, C-His tag MG50561-CH
CHST1 cDNA ORF Clone, Mouse, N-His tag MG50561-NH
CHST1 cDNA ORF Clone, Mouse, C-HA tag MG50561-CY
CHST1 cDNA ORF Clone, Mouse, N-HA tag MG50561-NY
CHST1 cDNA ORF Clone, Mouse, C-Myc tag MG50561-CM
CHST1 cDNA ORF Clone, Mouse, N-Myc tag MG50561-NM
CHST1 qPCR Primer Pairs, Mouse MP200553

CHST1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CHST1 cDNA ORF Clone in Cloning Vector, Human HG12306-G
CHST1 cDNA ORF Clone, Human, untagged HG12306-UT
CHST1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12306-ACGLN
CHST1 cDNA ORF Clone, Human, C-GFPSpark® tag HG12306-ACG
CHST1 cDNA ORF Clone, Human, C-OFPSpark® tag HG12306-ACR
CHST1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12306-CF
CHST1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12306-NF
CHST1 cDNA ORF Clone, Human, C-His tag HG12306-CH
CHST1 cDNA ORF Clone, Human, C-HA tag HG12306-CY
CHST1 cDNA ORF Clone, Human, N-HA tag HG12306-NY
CHST1 cDNA ORF Clone, Human, C-Myc tag HG12306-CM
CHST1 cDNA ORF Clone, Human, N-Myc tag HG12306-NM
CHST1 qPCR Primer Pairs, Human HP101939
info info
添加购物车成功! 添加购物车失败!