After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human Chordin-Like 1/CHRDL1 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human CHRDL1 cDNA Clone Product Information
NCBI RefSeq:NM_001143981.1
RefSeq ORF Size:1377bp
cDNA Description:Full length Clone DNA of Homo sapiens chordin-like 1 with N terminal His tag.
Gene Synonym:CHL, VOPT, NRLN1, dA141H5.1
Species:Human
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Cordin-like 1 (CHRDL1) is an antagonist of bone morphogenetic protein 4. It may play a role in topographic retinotectal projection and in the regulation of retinal angiogenesis in response to hypoxia. Cordin-like 1 (CHRDL1) is an inhibitor of the bone morphogenetic proteins (BMPs) that have functions in inducing ectopic bone formation. CHRDL1 acheves its inhibiting ability through affecting the osteogenic differentiation of MC3T3-E1 cells. Besides its function as an antagonist, CHRDL1 enhanced the proliferation of human mesenchymal stem cells in a BMP2-independent manner.

References
  • Fernandes H, et al. (2010) Effect of chordin-like 1 on MC3T3-E1 and human mesenchymal stem cells. Cells Tissues Organs. 191 (6): 443-52.
  • Larman BW, et al. (2009) Chordin-like 1 and twisted gastrulation 1 regulate BMP signaling following kidney injury. J Am Soc Nephrol. 20 (5): 1020-31.
  • Kane R, et al. (2008) Chordin-like 1, a bone morphogenetic protein-4 antagonist, is upregulated by hypoxia in human retinal pericytes and plays a role in regulating angiogenesis. Mol Vis. 14: 1138-48.
  •  

    Chordin-Like 1/CHRDL1 related areas, pathways, and other information

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"