CHMP5 cDNA ORF Clone, Human, N-Myc tag

Cat: HG14973-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CHMP5 Reagents
CRO Services
Product recommended

All CHMP5 Reagents
CHMP5 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
660 bp
Description
Full length Clone DNA of Human charged multivesicular body protein 5 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CHMP5 cDNA ORF Clone, Human, N-Myc tag Alternative Names
C9orf83 cDNA ORF Clone, Human;CGI-34 cDNA ORF Clone, Human;HSPC177 cDNA ORF Clone, Human;PNAS-2 cDNA ORF Clone, Human;SNF7DC2 cDNA ORF Clone, Human;Vps60 cDNA ORF Clone, Human
CHMP5 Background Information
Full Name
charged multivesicular body protein 5

CHMP5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CHMP5 cDNA ORF Clone in Cloning Vector, Mouse MG52652-G
CHMP5 cDNA ORF Clone, Mouse, untagged MG52652-UT
CHMP5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52652-ACG
CHMP5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52652-ACGLN
CHMP5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52652-ANG
CHMP5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52652-ACR
CHMP5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52652-ANR
CHMP5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52652-CF
CHMP5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52652-NF
CHMP5 cDNA ORF Clone, Mouse, C-His tag MG52652-CH
CHMP5 cDNA ORF Clone, Mouse, N-His tag MG52652-NH
CHMP5 cDNA ORF Clone, Mouse, C-HA tag MG52652-CY
CHMP5 cDNA ORF Clone, Mouse, N-HA tag MG52652-NY
CHMP5 cDNA ORF Clone, Mouse, C-Myc tag MG52652-CM
CHMP5 cDNA ORF Clone, Mouse, N-Myc tag MG52652-NM
CHMP5 qPCR Primer Pairs, Mouse MP202523

CHMP5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CHMP5 cDNA ORF Clone in Cloning Vector, Human HG14973-G
CHMP5 cDNA ORF Clone, Human, untagged HG14973-UT
CHMP5 cDNA ORF Clone, Human, C-GFPSpark® tag HG14973-ACG
CHMP5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14973-ACGLN
CHMP5 cDNA ORF Clone, Human, N-GFPSpark® tag HG14973-ANG
CHMP5 cDNA ORF Clone, Human, C-OFPSpark® tag HG14973-ACR
CHMP5 cDNA ORF Clone, Human, N-OFPSpark® tag HG14973-ANR
CHMP5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14973-CF
CHMP5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14973-NF
CHMP5 cDNA ORF Clone, Human, C-His tag HG14973-CH
CHMP5 cDNA ORF Clone, Human, N-His tag HG14973-NH
CHMP5 cDNA ORF Clone, Human, C-HA tag HG14973-CY
CHMP5 cDNA ORF Clone, Human, N-HA tag HG14973-NY
CHMP5 cDNA ORF Clone, Human, C-Myc tag HG14973-CM
CHMP5 qPCR Primer Pairs, Human HP103602
info info
添加购物车成功! 添加购物车失败!