Quick Order

Human CHL1/LICAM2/CALL Gene ORF cDNA clone expression plasmid, N-His tag

    DatasheetReviewsRelated ProductsProtocols
    Human CHL1 cDNA Clone Product Information
    NCBI RefSeq:NM_006614.2
    RefSeq ORF Size:3675bp
    cDNA Description:Full length Clone DNA of Homo sapiens CHL1 cell adhesion molecule with homology to L1CAM (close homolog of L1) with N terminal His tag.
    Gene Synonym:CHL1, CALL, L1CAM2, FLJ44930, MGC132578
    Species:Human
    Vector:pCMV3-SP-N-His
    Plasmid:
    Restriction Site:HindIII + XhoI
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CHL1 qPCR primers for gene expression analysis, HP100214 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    Background

    Neural cell adhesion molecule L1-like protein, also known as close homolog of L1 (CHL1) is the prototypic member of the CTF / NF-1 family of transcription factors that serve as a novel calcium signaling pathway-responsive transcription factor and is considered as a member of the largest ctf complementation group, consisting of 30 of 126 ctf mutants isolated. CHL1 is a cell adhesion molecule highly related to L1. It contains structure plan of six extracellular C2-type immunoglobulin (Ig) domains followed by five fibronectin typeⅢ domains linked by a single membrane-spanning region to a short cytoplasmic domain. The extracellular portion of CHL1 is higyly glycosylated and involved them in hemophilic disease.

    References
  • Alevizopoulos A, et al. (1997) Regulation of the Transforming Growth Factor beta-responsive Transcription Factor CTF-1 by Calcineurin and Calcium/ Calmodulin-dependent Protein Kinase IV. The Journal of Biological Chemistry. 272: 23597-605.
  • Gerring SL, et al. (1990) The CHL1 (CTF 1) gene product of Saccharomyces cerevisiae is important for chromosome transmission and normal cell cycle progression in G2 / M. EMBO J. 9 (13): 4347-58.
  • Wei MH, et al. (1998) In silico-initiated cloning and molecular characterization of a novel human member of the L1 gene family of neural cell adhesion molecules. Human Genetics. 103 (3): 355-64.
  • Size / Price
    Catalog: HG10143-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"