After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human YKL-39/CHI3L2 Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Human CHI3L2 cDNA Clone Product Information
NCBI RefSeq:BC011460
RefSeq ORF Size:1173bp
cDNA Description:Full length Clone DNA of Homo sapiens chitinase 3-like 2 with N terminal HA tag.
Gene Synonym:YKL39, YKL-39, CHI3L2
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Chondrocyte protein 39 (YKL-39), also known as Chitinase 3-like 2 (CHI3L2), is a secretory protein of articular chondrocytes belonging to the glycosyl hydrolase 18 family. It highest expression is in chondrocytes, followed by synoviocytes, lung and heart. YKL-39/CHI3L2 is not detected in spleen, pancreas, and liver. YKL-39/CHI3L2 may also be expressed in developing brain and placenta. YKL-39/CHI3L2, a cartilage-related protein, is found to induce arthritis accompanied by pathologic changes in bone and cartilage. A better understanding of the immune response against cartilage-related components including YKL-39 may help to elucidate the pathological processes of arthritic disorders. Up regulation of YKL-39/CHI3L2 in osteoarthritic cartilage suggests that YKL-39/CHI3L2 may be a more accurate marker of chondrocyte activation than YKL-40, although it has yet to be established as a suitable marker in synovial fluid and serum. The decreased expression of YKL-40 by osteoarthritic chondrocytes is surprising as increased levels have been reported in rheumatoid and osteoarthritic synovial fluid, where it may derive from activated synovial cells or osteophytic tissue or by increased matrix destruction in the osteoarthritic joint. YKL-39 and YKL-40 are potentially interesting marker molecules for arthritic joint disease because they are abundantly expressed by both normal and osteoarthritic chondrocytes.

References
  • Sakata M, et al. (2002) YKL-39, a human cartilage-related protein, induces arthritis in mice. Clin Exp Rheumatol. 20(3): 343-50.
  • Areshkov PA, et al. (2010) Chitinase 3-like protein 2 (CHI3L2, YKL-39) activates phosphorylation of extracellular signal-regulated kinases ERK1/ERK2 in human embryonic kidney (HEK293) and human glioblastoma (U87 MG) cells. Tsitol Genet. 44(1): 3-9.
  • Steck E, et al. (2002) Enhanced expression of the human chitinase 3-like 2 gene (YKL-39) but not chitinase 3-like 1 gene (YKL-40) in osteoarthritic cartilage. Biochem Biophys Res Commun. 299(1): 109-15.
  • Size / Price
    Catalog: HG12162-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"