CHCHD5 cDNA ORF Clone, Human, untagged

Cat: HG14485-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CHCHD5 Reagents
CRO Services
Product recommended

All CHCHD5 Reagents
CHCHD5 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
333 bp
Description
Full length Clone DNA of Human coiled-coil-helix-coiled-coil-helix domain containing 5.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CHCHD5 cDNA ORF Clone, Human, untagged Alternative Names
C2orf9 cDNA ORF Clone, Human;MIC14 cDNA ORF Clone, Human
CHCHD5 Background Information
Full Name
coiled-coil-helix-coiled-coil-helix domain containing 5

CHCHD5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CHCHD5 cDNA ORF Clone in Cloning Vector, Mouse MG54759-U
CHCHD5 cDNA ORF Clone, Mouse, untagged MG54759-UT
CHCHD5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG54759-ACGLN
CHCHD5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG54759-ACG
CHCHD5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG54759-ANG
CHCHD5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG54759-ACR
CHCHD5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG54759-ANR
CHCHD5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG54759-CF
CHCHD5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG54759-NF
CHCHD5 cDNA ORF Clone, Mouse, C-His tag MG54759-CH
CHCHD5 cDNA ORF Clone, Mouse, N-His tag MG54759-NH
CHCHD5 cDNA ORF Clone, Mouse, C-HA tag MG54759-CY
CHCHD5 cDNA ORF Clone, Mouse, N-HA tag MG54759-NY
CHCHD5 cDNA ORF Clone, Mouse, C-Myc tag MG54759-CM
CHCHD5 cDNA ORF Clone, Mouse, N-Myc tag MG54759-NM

CHCHD5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CHCHD5 cDNA ORF Clone in Cloning Vector, Human HG14485-G
CHCHD5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14485-ACGLN
CHCHD5 cDNA ORF Clone, Human, C-GFPSpark® tag HG14485-ACG
CHCHD5 cDNA ORF Clone, Human, N-GFPSpark® tag HG14485-ANG
CHCHD5 cDNA ORF Clone, Human, C-OFPSpark® tag HG14485-ACR
CHCHD5 cDNA ORF Clone, Human, N-OFPSpark® tag HG14485-ANR
CHCHD5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14485-CF
CHCHD5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14485-NF
CHCHD5 cDNA ORF Clone, Human, C-His tag HG14485-CH
CHCHD5 cDNA ORF Clone, Human, N-His tag HG14485-NH
CHCHD5 cDNA ORF Clone, Human, C-HA tag HG14485-CY
CHCHD5 cDNA ORF Clone, Human, N-HA tag HG14485-NY
CHCHD5 cDNA ORF Clone, Human, C-Myc tag HG14485-CM
CHCHD5 cDNA ORF Clone, Human, N-Myc tag HG14485-NM
CHCHD5 qPCR Primer Pairs, Human HP103133
info info
添加购物车成功! 添加购物车失败!