CHCHD2 cDNA ORF Clone, Human, C-Myc tag

Cat: HG14156-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CHCHD2 Reagents
CRO Services
Product recommended

All CHCHD2 Reagents
CHCHD2 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
456 bp
Description
Full length Clone DNA of Human coiled-coil-helix-coiled-coil-helix domain containing 2 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CHCHD2 cDNA ORF Clone, Human, C-Myc tag Alternative Names
C7orf17 cDNA ORF Clone, Human
CHCHD2 Background Information
Full Name
coiled-coil-helix-coiled-coil-helix domain containing 2

CHCHD2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CHCHD2 cDNA ORF Clone in Cloning Vector, Mouse MG53393-U
CHCHD2 cDNA ORF Clone, Mouse, untagged MG53393-UT
CHCHD2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53393-ACG
CHCHD2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53393-ACGLN
CHCHD2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53393-ANG
CHCHD2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53393-ACR
CHCHD2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53393-ANR
CHCHD2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53393-CF
CHCHD2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53393-NF
CHCHD2 cDNA ORF Clone, Mouse, C-His tag MG53393-CH
CHCHD2 cDNA ORF Clone, Mouse, N-His tag MG53393-NH
CHCHD2 cDNA ORF Clone, Mouse, C-HA tag MG53393-CY
CHCHD2 cDNA ORF Clone, Mouse, N-HA tag MG53393-NY
CHCHD2 cDNA ORF Clone, Mouse, C-Myc tag MG53393-CM
CHCHD2 cDNA ORF Clone, Mouse, N-Myc tag MG53393-NM

CHCHD2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CHCHD2 cDNA ORF Clone in Cloning Vector, Human HG14156-G
CHCHD2 cDNA ORF Clone, Human, untagged HG14156-UT
CHCHD2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14156-ACGLN
CHCHD2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14156-ACG
CHCHD2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14156-ANG
CHCHD2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14156-ACR
CHCHD2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14156-ANR
CHCHD2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14156-CF
CHCHD2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14156-NF
CHCHD2 cDNA ORF Clone, Human, C-His tag HG14156-CH
CHCHD2 cDNA ORF Clone, Human, N-His tag HG14156-NH
CHCHD2 cDNA ORF Clone, Human, C-HA tag HG14156-CY
CHCHD2 cDNA ORF Clone, Human, N-HA tag HG14156-NY
CHCHD2 cDNA ORF Clone, Human, N-Myc tag HG14156-NM
CHCHD2 qPCR Primer Pairs, Human HP102807
info info
添加购物车成功! 添加购物车失败!