CGGBP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG15148-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CGGBP1 Reagents
CRO Services
Product recommended

All CGGBP1 Reagents
CGGBP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
504 bp
Description
Full length Clone DNA of Human CGG triplet repeat binding protein 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CGGBP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
CGGBP cDNA ORF Clone, Human;p20-CGGBP cDNA ORF Clone, Human
CGGBP1 Background Information
Full Name
CGG triplet repeat binding protein 1

CGGBP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CGGBP1 cDNA ORF Clone in Cloning Vector, Mouse MG52039-U
CGGBP1 cDNA ORF Clone, Mouse, untagged MG52039-UT
CGGBP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52039-ACGLN
CGGBP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52039-ACG
CGGBP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52039-ANG
CGGBP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52039-ACR
CGGBP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52039-ANR
CGGBP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52039-CF
CGGBP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52039-NF
CGGBP1 cDNA ORF Clone, Mouse, C-His tag MG52039-CH
CGGBP1 cDNA ORF Clone, Mouse, N-His tag MG52039-NH
CGGBP1 cDNA ORF Clone, Mouse, C-HA tag MG52039-CY
CGGBP1 cDNA ORF Clone, Mouse, N-HA tag MG52039-NY
CGGBP1 cDNA ORF Clone, Mouse, C-Myc tag MG52039-CM
CGGBP1 cDNA ORF Clone, Mouse, N-Myc tag MG52039-NM
CGGBP1 qPCR Primer Pairs, Mouse MP201912

CGGBP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CGGBP1 cDNA ORF Clone in Cloning Vector, Human HG15148-G
CGGBP1 cDNA ORF Clone, Human, untagged HG15148-UT
CGGBP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15148-ACGLN
CGGBP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15148-ACG
CGGBP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15148-ANG
CGGBP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15148-ACR
CGGBP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15148-ANR
CGGBP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15148-CF
CGGBP1 cDNA ORF Clone, Human, C-His tag HG15148-CH
CGGBP1 cDNA ORF Clone, Human, N-His tag HG15148-NH
CGGBP1 cDNA ORF Clone, Human, C-HA tag HG15148-CY
CGGBP1 cDNA ORF Clone, Human, N-HA tag HG15148-NY
CGGBP1 cDNA ORF Clone, Human, C-Myc tag HG15148-CM
CGGBP1 cDNA ORF Clone, Human, N-Myc tag HG15148-NM
CGGBP1 qPCR Primer Pairs, Human HP103775
info info
添加购物车成功! 添加购物车失败!