Cofilin 2 cDNA ORF Clone, Human, N-His tag

Cat: HG11463-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Cofilin 2 Reagents
CRO Services
Product recommended

All Cofilin 2 Reagents
Cofilin 2 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
501 bp
Description
Full length Clone DNA of Human cofilin 2 (muscle) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cofilin 2 cDNA ORF Clone, Human, N-His tag Alternative Names
NEM7 cDNA ORF Clone, Human
Cofilin 2 Background Information

Cofilin 2 (muscle), also known as CFL2, is a member of cofilin family of the actin-binding protein superfamily. Cofilin2 shows significant homology to the other two members: cofilin 1 and DSTN, through its entire sequence, and contains residues conserved among the cofilin family that are responsible for actin-binding. Cofilin 2 (CFL2) is an important regulator of striated myocyte function. Purified cofilin 2 depolymerized actin filaments in a dose- and pH-dependent manner and reduced the apparent viscosity of an actin solution, although they did not co-sediment with actin filaments at all. Cofilin2 is not expressed in vegetative cells, but is transiently induced during the aggregation stage of development, whereas cofilin 1 was predominantly expressed in vegetative cells. 

Full Name
cofilin 2 (muscle)
References
  • Aizawa H, et al. (2001) Cofilin-2, a novel type of cofilin, is expressed specifically at aggregation stage of Dictyostelium discoideum development. Genes Cells. 6 (10): 913-21.
  • Papalouka V, et al. (2009) Muscle LIM protein interacts with cofilin 2 and regulates F-actin dynamics in cardiac and skeletal muscle. Papalouka V, Mol Cell Biol. 29 (22): 6046-58.
  • Cofilin 2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Cofilin 2 cDNA ORF Clone in Cloning Vector, Rat RG81236-U
    Cofilin 2 cDNA ORF Clone, Rat, untagged RG81236-UT
    Cofilin 2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81236-ACG
    Cofilin 2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81236-ACGLN
    Cofilin 2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81236-ANG
    Cofilin 2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81236-ACR
    Cofilin 2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81236-ANR
    Cofilin 2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81236-CF
    Cofilin 2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81236-NF
    Cofilin 2 cDNA ORF Clone, Rat, C-His tag RG81236-CH
    Cofilin 2 cDNA ORF Clone, Rat, N-His tag RG81236-NH
    Cofilin 2 cDNA ORF Clone, Rat, C-HA tag RG81236-CY
    Cofilin 2 cDNA ORF Clone, Rat, N-HA tag RG81236-NY
    Cofilin 2 cDNA ORF Clone, Rat, C-Myc tag RG81236-CM
    Cofilin 2 cDNA ORF Clone, Rat, N-Myc tag RG81236-NM
    Cofilin 2 qPCR Primer Pairs, Rat RP301192

    Cofilin 2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Cofilin 2 cDNA ORF Clone in Cloning Vector, Mouse MG51672-G
    Cofilin 2 cDNA ORF Clone, Mouse, untagged MG51672-UT
    Cofilin 2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51672-ACG
    Cofilin 2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51672-ACGLN
    Cofilin 2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51672-ANG
    Cofilin 2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51672-ACR
    Cofilin 2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51672-ANR
    Cofilin 2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51672-CF
    Cofilin 2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51672-NF
    Cofilin 2 cDNA ORF Clone, Mouse, C-His tag MG51672-CH
    Cofilin 2 cDNA ORF Clone, Mouse, N-His tag MG51672-NH
    Cofilin 2 cDNA ORF Clone, Mouse, C-HA tag MG51672-CY
    Cofilin 2 cDNA ORF Clone, Mouse, N-HA tag MG51672-NY
    Cofilin 2 cDNA ORF Clone, Mouse, C-Myc tag MG51672-CM
    Cofilin 2 cDNA ORF Clone, Mouse, N-Myc tag MG51672-NM
    Cofilin 2 qPCR Primer Pairs, Mouse MP201545

    Cofilin 2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Cofilin 2 cDNA ORF Clone in Cloning Vector, Human HG11463-M
    Cofilin 2 cDNA ORF Clone, Human, untagged HG11463-UT
    Cofilin 2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11463-ACG
    Cofilin 2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11463-ACGLN
    Cofilin 2 cDNA ORF Clone, Human, N-GFPSpark® tag HG11463-ANG
    Cofilin 2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11463-ACR
    Cofilin 2 cDNA ORF Clone, Human, N-OFPSpark® tag HG11463-ANR
    Cofilin 2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11463-CF
    Cofilin 2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11463-NF
    Cofilin 2 cDNA ORF Clone, Human, C-His tag HG11463-CH
    Cofilin 2 cDNA ORF Clone, Human, C-HA tag HG11463-CY
    Cofilin 2 cDNA ORF Clone, Human, N-HA tag HG11463-NY
    Cofilin 2 cDNA ORF Clone, Human, C-Myc tag HG11463-CM
    Cofilin 2 cDNA ORF Clone, Human, N-Myc tag HG11463-NM
    Cofilin 2 qPCR Primer Pairs, Human HP101340
    info info
    添加购物车成功! 添加购物车失败!