CFDP1 cDNA ORF Clone, Human, N-His tag

Cat: HG11465-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CFDP1 Reagents
CRO Services
Product recommended

All CFDP1 Reagents
CFDP1 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
900 bp
Description
Full length Clone DNA of Human craniofacial development protein 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CFDP1 cDNA ORF Clone, Human, N-His tag Alternative Names
BCNT cDNA ORF Clone, Human;BUCENTAUR cDNA ORF Clone, Human;CENP-29 cDNA ORF Clone, Human;CP27 cDNA ORF Clone, Human;p97 cDNA ORF Clone, Human;SWC5 cDNA ORF Clone, Human;Yeti cDNA ORF Clone, Human
CFDP1 Background Information
Full Name
craniofacial development protein 1

CFDP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CFDP1 cDNA ORF Clone in Cloning Vector, Mouse MG53566-G
CFDP1 cDNA ORF Clone, Mouse, untagged MG53566-UT
CFDP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53566-ACG
CFDP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53566-ACGLN
CFDP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53566-ANG
CFDP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53566-ACR
CFDP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53566-ANR
CFDP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53566-CF
CFDP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53566-NF
CFDP1 cDNA ORF Clone, Mouse, C-His tag MG53566-CH
CFDP1 cDNA ORF Clone, Mouse, N-His tag MG53566-NH
CFDP1 cDNA ORF Clone, Mouse, C-HA tag MG53566-CY
CFDP1 cDNA ORF Clone, Mouse, N-HA tag MG53566-NY
CFDP1 cDNA ORF Clone, Mouse, C-Myc tag MG53566-CM
CFDP1 cDNA ORF Clone, Mouse, N-Myc tag MG53566-NM

CFDP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CFDP1 cDNA ORF Clone in Cloning Vector, Human HG11465-M
CFDP1 cDNA ORF Clone, Human, untagged HG11465-UT
CFDP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11465-ACGLN
CFDP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11465-ACG
CFDP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11465-ANG
CFDP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11465-ACR
CFDP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11465-ANR
CFDP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11465-CF
CFDP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11465-NF
CFDP1 cDNA ORF Clone, Human, C-His tag HG11465-CH
CFDP1 cDNA ORF Clone, Human, C-HA tag HG11465-CY
CFDP1 cDNA ORF Clone, Human, N-HA tag HG11465-NY
CFDP1 cDNA ORF Clone, Human, C-Myc tag HG11465-CM
CFDP1 cDNA ORF Clone, Human, N-Myc tag HG11465-NM
CFDP1 qPCR Primer Pairs, Human HP101342
info info
添加购物车成功! 添加购物车失败!