Centrin 2 cDNA ORF Clone, Human, N-Myc tag

Cat: HG14983-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Centrin 2 Reagents
CRO Services
Product recommended

All Centrin 2 Reagents
Centrin 2 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
519 bp
Description
Full length Clone DNA of Human centrin, EF-hand protein, 2 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Centrin 2 cDNA ORF Clone, Human, N-Myc tag Alternative Names
CALT cDNA ORF Clone, Human;CEN2 cDNA ORF Clone, Human
Centrin 2 Background Information
Full Name
centrin, EF-hand protein, 2

Centrin 2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Centrin 2 cDNA ORF Clone in Cloning Vector, Rat RG80488-U
Centrin 2 cDNA ORF Clone, Rat, untagged RG80488-UT
Centrin 2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80488-ACGLN
Centrin 2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80488-ACG
Centrin 2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80488-ANG
Centrin 2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80488-ACR
Centrin 2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80488-ANR
Centrin 2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80488-CF
Centrin 2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80488-NF
Centrin 2 cDNA ORF Clone, Rat, C-His tag RG80488-CH
Centrin 2 cDNA ORF Clone, Rat, N-His tag RG80488-NH
Centrin 2 cDNA ORF Clone, Rat, C-HA tag RG80488-CY
Centrin 2 cDNA ORF Clone, Rat, N-HA tag RG80488-NY
Centrin 2 cDNA ORF Clone, Rat, C-Myc tag RG80488-CM
Centrin 2 cDNA ORF Clone, Rat, N-Myc tag RG80488-NM
Centrin 2 qPCR Primer Pairs, Rat RP300452

Centrin 2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Centrin 2 cDNA ORF Clone in Cloning Vector, Human HG14983-G
Centrin 2 cDNA ORF Clone, Human, untagged HG14983-UT
Centrin 2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14983-ACGLN
Centrin 2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14983-ACG
Centrin 2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14983-ANG
Centrin 2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14983-ACR
Centrin 2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14983-ANR
Centrin 2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14983-CF
Centrin 2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14983-NF
Centrin 2 cDNA ORF Clone, Human, C-His tag HG14983-CH
Centrin 2 cDNA ORF Clone, Human, N-His tag HG14983-NH
Centrin 2 cDNA ORF Clone, Human, C-HA tag HG14983-CY
Centrin 2 cDNA ORF Clone, Human, N-HA tag HG14983-NY
Centrin 2 cDNA ORF Clone, Human, C-Myc tag HG14983-CM
Centrin 2 qPCR Primer Pairs, Human HP103611
info info
添加购物车成功! 添加购物车失败!