CUG-BP1/CELF1 cDNA ORF Clone, Human, N-Myc tag

Cat: HG11523-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CUG-BP1/CELF1 Reagents
CRO Services
Product recommended

All CUG-BP1/CELF1 Reagents
CUG-BP1/CELF1 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1461 bp
Description
Full length Clone DNA of Human CUGBP, Elav-like family member 1 transcript variant 3 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CUG-BP1/CELF1 cDNA ORF Clone, Human, N-Myc tag Alternative Names
BRUNOL2 cDNA ORF Clone, Human;CUG-BP cDNA ORF Clone, Human;CUGBP cDNA ORF Clone, Human;CUGBP1 cDNA ORF Clone, Human;EDEN-BP cDNA ORF Clone, Human;hNab50 cDNA ORF Clone, Human;NAB50 cDNA ORF Clone, Human;NAPOR cDNA ORF Clone, Human
CUG-BP1/CELF1 Background Information
Full Name
CUGBP, Elav-like family member 1

CUG-BP1/CELF1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CUG-BP1/CELF1 cDNA ORF Clone in Cloning Vector, Mouse MG58711-U
CUG-BP1/CELF1 cDNA ORF Clone, Mouse, untagged MG58711-UT
CUG-BP1/CELF1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58711-ACGLN
CUG-BP1/CELF1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58711-ACG
CUG-BP1/CELF1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG58711-ANG
CUG-BP1/CELF1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58711-ACR
CUG-BP1/CELF1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG58711-ANR
CUG-BP1/CELF1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58711-CF
CUG-BP1/CELF1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58711-NF
CUG-BP1/CELF1 cDNA ORF Clone, Mouse, C-His tag MG58711-CH
CUG-BP1/CELF1 cDNA ORF Clone, Mouse, N-His tag MG58711-NH
CUG-BP1/CELF1 cDNA ORF Clone, Mouse, C-HA tag MG58711-CY
CUG-BP1/CELF1 cDNA ORF Clone, Mouse, N-HA tag MG58711-NY
CUG-BP1/CELF1 cDNA ORF Clone, Mouse, C-Myc tag MG58711-CM
CUG-BP1/CELF1 cDNA ORF Clone, Mouse, N-Myc tag MG58711-NM

CUG-BP1/CELF1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CUG-BP1/CELF1 cDNA ORF Clone in Cloning Vector, Human HG11523-M
CUG-BP1/CELF1 cDNA ORF Clone, Human, untagged HG11523-UT
CUG-BP1/CELF1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11523-ACG
CUG-BP1/CELF1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11523-ACGLN
CUG-BP1/CELF1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11523-ANG
CUG-BP1/CELF1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11523-ACR
CUG-BP1/CELF1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11523-ANR
CUG-BP1/CELF1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11523-CF
CUG-BP1/CELF1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11523-NF
CUG-BP1/CELF1 cDNA ORF Clone, Human, C-His tag HG11523-CH
CUG-BP1/CELF1 cDNA ORF Clone, Human, N-His tag HG11523-NH
CUG-BP1/CELF1 cDNA ORF Clone, Human, C-HA tag HG11523-CY
CUG-BP1/CELF1 cDNA ORF Clone, Human, N-HA tag HG11523-NY
CUG-BP1/CELF1 cDNA ORF Clone, Human, C-Myc tag HG11523-CM
CUG-BP1/CELF1 qPCR Primer Pairs, Human HP101667
info info
添加购物车成功! 添加购物车失败!