Quick Order

Human CUG-BP1/CELF1 transcript variant 3 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human CELF1 cDNA Clone Product Information
NCBI RefSeq:NM_001025596.2
RefSeq ORF Size:1461bp
cDNA Description:Full length Clone DNA of Homo sapiens CUGBP, Elav-like family member 1 transcript variant 3 with N terminal His tag.
Gene Synonym:CUGBP, NAB50, NAPOR, CUG-BP, CUGBP1, hNab50, BRUNOL2, EDEN-BP, CELF1
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Human CUG-BP1/CELF1 transcript variant 3 Gene ORF cDNA clone expression plasmid, N-His tag on other vectors
Human CUG-BP1/CELF1 transcript variant 3 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG11523-ACG$225
Human CUG-BP1/CELF1 transcript variant 3 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG11523-ACR$225
Human CUG-BP1/CELF1 transcript variant 3 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG11523-ANG$225
Human CUG-BP1/CELF1 transcript variant 3 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG11523-ANR$225
Human CUG-BP1/CELF1 transcript variant 3 Gene ORF cDNA clone expression plasmid, C-Flag tagHG11523-CF$195
Human CUG-BP1/CELF1 transcript variant 3 Gene ORF cDNA clone expression plasmid, C-His tagHG11523-CH$195
Human CUG-BP1/CELF1 transcript variant 3 Gene ORF cDNA clone expression plasmid, C-Myc tagHG11523-CM$195
Human CUG-BP1/CELF1 transcript variant 3 Gene ORF cDNA clone expression plasmid, C-HA tagHG11523-CY$195
Human CELF1 transcript variant 3 Gene cDNA clone plasmidHG11523-M$75
Human CUG-BP1/CELF1 transcript variant 3 Gene ORF cDNA clone expression plasmidHG11523-M-N$195
Human CUG-BP1/CELF1 transcript variant 3 Gene ORF cDNA clone expression plasmid, N-Flag tagHG11523-NF$195
Human CUG-BP1/CELF1 transcript variant 3 Gene ORF cDNA clone expression plasmid, N-His tagHG11523-NH$195
Human CUG-BP1/CELF1 transcript variant 3 Gene ORF cDNA clone expression plasmid, N-Myc tagHG11523-NM$195
Human CUG-BP1/CELF1 transcript variant 3 Gene ORF cDNA clone expression plasmid, N-HA tagHG11523-NY$195
Human CUG-BP1/CELF1 transcript variant 3 Gene ORF cDNA clone expression plasmidHG11523-UT$195
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: HG11523-NH
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"