CEBP gamma cDNA ORF Clone, Human, N-His tag

Cat: HG14925-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CEBP gamma Reagents
CRO Services
Product recommended

All CEBP gamma Reagents
CEBP gamma cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
453 bp
Description
Full length Clone DNA of Human CCAAT/enhancer binding protein (C/EBP), gamma with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CEBP gamma cDNA ORF Clone, Human, N-His tag Alternative Names
GPE1BP cDNA ORF Clone, Human;IG/EBP-1 cDNA ORF Clone, Human
CEBP gamma Background Information

CEBPG, also known as CEBP gamma, is a transcription factor which belongs to the CEBP family. Members of this family regulate viral and cellular CCAAT/enhancer element-mediated transcription. CEBP proteins contain the bZIP region, which is characterized by two motifs in the C-terminal half of the protein: a basic region involved in DNA binding and a leucine zipper motif involved in dimerization. CEBPG binds to the enhancer element PRE-I of the IL-4 gene. It Might change the DNA-binding specificity of other transcription factors and recruit them to unusual DNA sites.

Full Name
CCAAT/enhancer binding protein (C/EBP), gamma
References
  • Thomassin H. et al., 1992, Nucleic Acids Res. 20 (12): 3091-8.
  • Nishizawa M. et al., 1992, FEBS Lett. 299 (1): 36-8.
  • Williams SC. et al., 1991, Genes Dev. 5 (9): 1553-67.
  • Melchionna R. et al., 2012, J Invest Dermatol. 132 (7): 1908-17.
  • CEBP gamma cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CEBP gamma cDNA ORF Clone in Cloning Vector, Mouse MG59307-U
    CEBP gamma cDNA ORF Clone, Mouse, untagged MG59307-UT
    CEBP gamma Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59307-ACGLN
    CEBP gamma cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59307-ACG
    CEBP gamma cDNA ORF Clone, Mouse, N-GFPSpark® tag MG59307-ANG
    CEBP gamma cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59307-ACR
    CEBP gamma cDNA ORF Clone, Mouse, N-OFPSpark® tag MG59307-ANR
    CEBP gamma cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59307-CF
    CEBP gamma cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59307-NF
    CEBP gamma cDNA ORF Clone, Mouse, C-His tag MG59307-CH
    CEBP gamma cDNA ORF Clone, Mouse, N-His tag MG59307-NH
    CEBP gamma cDNA ORF Clone, Mouse, C-HA tag MG59307-CY
    CEBP gamma cDNA ORF Clone, Mouse, N-HA tag MG59307-NY
    CEBP gamma cDNA ORF Clone, Mouse, C-Myc tag MG59307-CM
    CEBP gamma cDNA ORF Clone, Mouse, N-Myc tag MG59307-NM

    CEBP gamma cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CEBP gamma cDNA ORF Clone in Cloning Vector, Human HG14925-G
    CEBP gamma cDNA ORF Clone, Human, untagged HG14925-UT
    CEBP gamma Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14925-ACGLN
    CEBP gamma cDNA ORF Clone, Human, C-GFPSpark® tag HG14925-ACG
    CEBP gamma cDNA ORF Clone, Human, N-GFPSpark® tag HG14925-ANG
    CEBP gamma cDNA ORF Clone, Human, C-OFPSpark® tag HG14925-ACR
    CEBP gamma cDNA ORF Clone, Human, N-OFPSpark® tag HG14925-ANR
    CEBP gamma cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14925-CF
    CEBP gamma cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14925-NF
    CEBP gamma cDNA ORF Clone, Human, C-His tag HG14925-CH
    CEBP gamma cDNA ORF Clone, Human, C-HA tag HG14925-CY
    CEBP gamma cDNA ORF Clone, Human, N-HA tag HG14925-NY
    CEBP gamma cDNA ORF Clone, Human, C-Myc tag HG14925-CM
    CEBP gamma cDNA ORF Clone, Human, N-Myc tag HG14925-NM
    CEBP gamma qPCR Primer Pairs, Human HP103554
    info info
    添加购物车成功! 添加购物车失败!