CEBPE cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG15164-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CEBPE Reagents
CRO Services
Product recommended

All CEBPE Reagents
CEBPE cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
846 bp
Description
Full length Clone DNA of Human CCAAT/enhancer binding protein (C/EBP), epsilon with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CEBPE cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
C/EBP-epsilon cDNA ORF Clone, Human;CRP1 cDNA ORF Clone, Human
CEBPE Background Information
Full Name
CCAAT/enhancer binding protein (C/EBP), epsilon

CEBPE cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CEBPE cDNA ORF Clone in Cloning Vector, Mouse MG53327-U
CEBPE cDNA ORF Clone, Mouse, untagged MG53327-UT
CEBPE cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53327-ACG
CEBPE Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53327-ACGLN
CEBPE cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53327-ANG
CEBPE cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53327-ACR
CEBPE cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53327-ANR
CEBPE cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53327-CF
CEBPE cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53327-NF
CEBPE cDNA ORF Clone, Mouse, C-His tag MG53327-CH
CEBPE cDNA ORF Clone, Mouse, N-His tag MG53327-NH
CEBPE cDNA ORF Clone, Mouse, C-HA tag MG53327-CY
CEBPE cDNA ORF Clone, Mouse, N-HA tag MG53327-NY
CEBPE cDNA ORF Clone, Mouse, C-Myc tag MG53327-CM
CEBPE cDNA ORF Clone, Mouse, N-Myc tag MG53327-NM

CEBPE cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CEBPE cDNA ORF Clone in Cloning Vector, Human HG15164-G
CEBPE cDNA ORF Clone, Human, untagged HG15164-UT
CEBPE Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15164-ACGLN
CEBPE cDNA ORF Clone, Human, C-GFPSpark® tag HG15164-ACG
CEBPE cDNA ORF Clone, Human, N-GFPSpark® tag HG15164-ANG
CEBPE cDNA ORF Clone, Human, C-OFPSpark® tag HG15164-ACR
CEBPE cDNA ORF Clone, Human, N-OFPSpark® tag HG15164-ANR
CEBPE cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15164-NF
CEBPE cDNA ORF Clone, Human, C-His tag HG15164-CH
CEBPE cDNA ORF Clone, Human, N-His tag HG15164-NH
CEBPE cDNA ORF Clone, Human, C-HA tag HG15164-CY
CEBPE cDNA ORF Clone, Human, N-HA tag HG15164-NY
CEBPE cDNA ORF Clone, Human, C-Myc tag HG15164-CM
CEBPE cDNA ORF Clone, Human, N-Myc tag HG15164-NM
CEBPE qPCR Primer Pairs, Human HP103791
info info
添加购物车成功! 添加购物车失败!